Unlock instant, AI-driven research and patent intelligence for your innovation.

amiRNA capable of improving PSTVd resistance of potatoes and application thereof

A potato and resistance technology, applied in the direction of DNA / RNA fragments, application, recombinant DNA technology, etc., can solve the problems of limited use of silent disease resistance mechanisms, no better way, no reports of viroids and major viral diseases, etc. , to achieve the effect of promoting the development of research

Pending Publication Date: 2020-01-14
SOUTHWEST UNIVERSITY
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0009] However, at present, there is no better way in the world for the prevention and treatment of viroids, and there is no report on the research on simultaneous prevention and treatment of viroids and major viral diseases.
Viroids cannot be effectively resolved by drugs and stem tip stripping; due to the high-level structure of viroid RNA, the use of small RNAs to directly target viroid RNA's silencing and disease resistance mechanisms is limited

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • amiRNA capable of improving PSTVd resistance of potatoes and application thereof
  • amiRNA capable of improving PSTVd resistance of potatoes and application thereof
  • amiRNA capable of improving PSTVd resistance of potatoes and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Embodiment 1, the acquisition of potato brp gene sequence

[0028] Genomic DNA of potato variety Kexin 18 was used as a template for PCR amplification. The upstream primer was: 5'-atggcatccgccgtcttagctag-3' (SEQ ID NO.1), and the downstream primer was: 5'-ctcaagagtgtgcatcatcagc-3' (SEQ ID NO.2), the amplification conditions are pre-denaturation at 94°C for 4 minutes; denaturation at 94°C for 60 seconds, annealing at 55°C for 30 seconds, extension at 72°C for 90 seconds, a total of 30 cycles; final extension at 72°C for 10 minutes, and storage at 4°C. The sequence shown in SEQ ID NO.3 was obtained.

Embodiment 2

[0029] Embodiment 2, the acquisition of target potato brp gene amiRNA sequence

[0030] Through gene sequencing and sequence structure analysis, a 21nt gene sequence was selected downstream of the 3' end of the nuclear localization signal, and the sequence was synthesized to obtain the amiRNA sequence targeting the potato brp gene, 5'-gtctcttacaaacaaggcgag-3' (SEQID NO.4) , and 5'-gcaaagctgatagagcataaa-3' (SEQ ID NO.5) was used as a control.

Embodiment 3

[0031] Embodiment 3, construction contains the recombinant vector and the engineered bacterium of the pre-amiRNA targeting potato Brp gene

[0032] A. Acquisition of pre-amiRNA gene sequence

[0033] PCR amplification was performed using ath-pre-miRNA159 as a template, and the primers contained the sequence shown in SEQ ID NO.4.

[0034] The upstream primer is: 5'- Actagt tgacgatggaaggtctcttacaaacaaggcgagatgagttgagcagggta-3' (SEQ ID NO.6), the underline is the XbaⅠ restriction site, and the boldface is the amiRNA sequence targeting the potato brp gene;

[0035] The downstream primer is: 5'- gagctc atggtctcttacaacaaaggcgaggaagagtaaaagcca-3' (SEQ ID NO.7), the underline is the SacⅠ restriction site;

[0036] The amplification conditions were pre-denaturation at 98°C for 4 minutes; denaturation at 98°C for 60 seconds, annealing at 55°C for 30 seconds, and extension at 72°C for 60 seconds, a total of 30 cycles; the final extension at 72°C for 10 minutes, and storage at 4°C to...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses amiRNA capable of improving PSTVd resistance of potatoes and application thereof. The amiRNA has a nucleic acid sequence shown as SEQ ID NO. 4; artificial miRNAs are expressedby utilizing a micro-RNA expression strategy, thereby obtaining transgenic potatoes with relatively good anti-PSTVd effects; and moreover, the transgenic potatoes have no significant difference from wild-type potatoes in the aspect of biological phenotype. The method requires no long disease-source cDNA fragments, so that effective micro-RNAs are not diluted by a large amount of ineffective micro-RNAs produced by long cDNA fragments; and thus, ''target missing'' of artificial miRNAs without homology can be avoided so as to avoid cause of plant development defects. The method is also capable ofavoiding biosafety problems brought by long-segment RNA homologous complementation in agricultural production and application; and moreover, some theoretical reference for transgenic disease-resistant breeding work for other crops is also provided so as to promote development of molecular disease resistance breeding of crops in China.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to an amiRNA for improving potato PSTVd ​​resistance, and also relates to the application of the amiRNA for improving potato PSTVd ​​resistance. Background technique [0002] Potato spindle tuber viroid (PSTVd) is an important disease affecting seed potato quality. The disease can be transmitted from generation to generation with the asexual reproduction of seed potatoes, and with the increase of the number of infected generations, the symptoms will become more serious, the yield will decrease sharply, the tubers will become smaller, cracked, and deformed, and they will basically lose their commerciality and become seedless. Use value. [0003] The main way to solve the degradation of potato seed potatoes at home and abroad is to eliminate viruses through stem tip stripping and tissue culture, establish a virus-free seed potato breeding system, and produce healthy seed potatoes. Howev...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/82A01H5/00A01H6/82
CPCC12N15/113C12N15/8218C12N15/8283C12N2310/141
Inventor 吕典秋刘尚武郭惠珊房媛媛赵建华宿飞飞李辉
Owner SOUTHWEST UNIVERSITY