SgRNA, CREBRF point mutation-type Bama miniature pig constructed by sgRNA and application
A point mutation and obesity model technology, applied in DNA/RNA fragments, applications, DNA preparation, etc., can solve problems such as increased risk of disease and no drugs
- Summary
- Abstract
- Description
- Claims
- Application Information
 AI Technical Summary 
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0048] The CEREBRF sequence alignment of embodiment 1 people and Bama fragrant pig
[0049] In this example, by comparing the homology of CEREBRF genes between humans and Bama pigs, it was determined that Bama pigs were used to construct obesity model organisms.
[0050] like figure 1 Shown is the comparison result of the CREBRF amino acid sequence between human and Bama pig. It can be seen that the 457th amino acid between human and Bama pig is arginine, and the identity is greater than 99%. The CEREBRF genes of Xiang pigs are all G at 1370 positions, with an identity greater than 94%. It can be seen that Bama pigs have a high genetic similarity with humans, and it is determined to use Bama pigs to construct obesity model organisms.
[0051] The CEREBRF gene sequence is shown in SEQ ID NO:4, the underlined base is the 1370th G, SEQ ID NO:4:
[0052] TGACAAGGATGATGATATTAGTGATACTTTCTCTGAACCAGGCTATGAAAATGATTCTGTAGAAGACCTGAAGGAGGTGACTTCAATATCTTCACGGAAGAGAGGTAAAAGAAGATACTTCTGGG...
Embodiment 2
[0053] CEREBRF sequence alignment among individual Bamaxiang pigs of embodiment 2
[0054] In this example, by comparing the homology of the CEREBRF gene among different Bamaxiang pig individuals, it is determined whether there is a SNP site in the 1370 position of the CEREBRF gene in the Bamaxiang pig.
[0055] The CEREBRF gene was amplified using the primer pairs shown in SEQ ID NO: 5-6, and the amplified product was sequenced to obtain the result shown in SEQ ID NO: 7. The underlined base was the 1370th G, and it was found that There was no SNP at position 1370 of the CEREBRF gene among different individuals of Horsexiang pigs.
[0056] CREBRF-F (SEQ ID NO:5): 5'-ATCTTTTTGTTTGTCCTGATTGGGT-3';
[0057] CREBRF-R (SEQ ID NO:6): 5'-GAAGGAAGGGGGAAGGGATAC-3';
[0058] Porcine CREBRF gene (SEQ ID NO:7):
[0059] tgtgaatagtgcttcagtgaacatcatggtgtattcttcccagtttttgatggggttatttgttttcctgtgggtctgtttcattgttttctcaatcttaggtgaaggtacaaaaaaagtatcatacactaaccaaagagaaacctaaggaatatagacagtgtcgtt...
Embodiment 3
[0060] Example 3 The 1370 point mutation of CEREBRF gene
[0061] In this example, CRISPR / Cas9 technology was used to design an sgRNA recognition sequence near the 1370th position of the CEREBRF gene of Bamaxiang pig, and a single-stranded DNA that mutated the 1370th G into A. Wherein, the sgRNA as shown in SEQ ID NO:1~2 makes CRISPR / Cas9 in the target site SEQ ID NO:8( tgg for the PAM region) to perform specific recognition and cleavage to form double-stranded DNA breaks (Double Strand Breaks, DSB), and promote homologous recombination repair of exogenous single-stranded DNA SEQ ID NO: 3 (ssODNA) as a template; CREBRFoligogo-g1 ( Both ends of SEQ ID NO:1) and CREBRFoligogo-g2 (SEQ ID NO:2) have BbsI restriction sites, the single-stranded DNA SEQ ID NO:3 is 86bp in length, with homology arms on both sides, at position 1370 G Replace it with A, and in order to prevent CRISPR / Cas9 from re-targeting the target site, a synonymous mutation is designed at the recognition site of t...
PUM
 Login to View More
 Login to View More Abstract
Description
Claims
Application Information
 Login to View More
 Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



