Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

SgRNA, CREBRF point mutation-type Bama miniature pig constructed by sgRNA and application

A point mutation and obesity model technology, applied in DNA/RNA fragments, applications, DNA preparation, etc., can solve problems such as increased risk of disease and no drugs

Active Publication Date: 2020-03-06
GUANGZHOU INST OF BIOMEDICINE & HEALTH CHINESE ACAD OF SCI
View PDF6 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0002] In recent years, with the improvement of economic level and quality of life, the incidence of obesity and diabetes has increased significantly. These two diseases are affected by many factors such as environment and genetics. So far, there is no effective cure

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • SgRNA, CREBRF point mutation-type Bama miniature pig constructed by sgRNA and application
  • SgRNA, CREBRF point mutation-type Bama miniature pig constructed by sgRNA and application
  • SgRNA, CREBRF point mutation-type Bama miniature pig constructed by sgRNA and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] The CEREBRF sequence alignment of embodiment 1 people and Bama fragrant pig

[0049] In this example, by comparing the homology of CEREBRF genes between humans and Bama pigs, it was determined that Bama pigs were used to construct obesity model organisms.

[0050] like figure 1 Shown is the comparison result of the CREBRF amino acid sequence between human and Bama pig. It can be seen that the 457th amino acid between human and Bama pig is arginine, and the identity is greater than 99%. The CEREBRF genes of Xiang pigs are all G at 1370 positions, with an identity greater than 94%. It can be seen that Bama pigs have a high genetic similarity with humans, and it is determined to use Bama pigs to construct obesity model organisms.

[0051] The CEREBRF gene sequence is shown in SEQ ID NO:4, the underlined base is the 1370th G, SEQ ID NO:4:

[0052] TGACAAGGATGATGATATTAGTGATACTTTCTCTGAACCAGGCTATGAAAATGATTCTGTAGAAGACCTGAAGGAGGTGACTTCAATATCTTCACGGAAGAGAGGTAAAAGAAGATACTTCTGGG...

Embodiment 2

[0053] CEREBRF sequence alignment among individual Bamaxiang pigs of embodiment 2

[0054] In this example, by comparing the homology of the CEREBRF gene among different Bamaxiang pig individuals, it is determined whether there is a SNP site in the 1370 position of the CEREBRF gene in the Bamaxiang pig.

[0055] The CEREBRF gene was amplified using the primer pairs shown in SEQ ID NO: 5-6, and the amplified product was sequenced to obtain the result shown in SEQ ID NO: 7. The underlined base was the 1370th G, and it was found that There was no SNP at position 1370 of the CEREBRF gene among different individuals of Horsexiang pigs.

[0056] CREBRF-F (SEQ ID NO:5): 5'-ATCTTTTTGTTTGTCCTGATTGGGT-3';

[0057] CREBRF-R (SEQ ID NO:6): 5'-GAAGGAAGGGGGAAGGGATAC-3';

[0058] Porcine CREBRF gene (SEQ ID NO:7):

[0059] tgtgaatagtgcttcagtgaacatcatggtgtattcttcccagtttttgatggggttatttgttttcctgtgggtctgtttcattgttttctcaatcttaggtgaaggtacaaaaaaagtatcatacactaaccaaagagaaacctaaggaatatagacagtgtcgtt...

Embodiment 3

[0060] Example 3 The 1370 point mutation of CEREBRF gene

[0061] In this example, CRISPR / Cas9 technology was used to design an sgRNA recognition sequence near the 1370th position of the CEREBRF gene of Bamaxiang pig, and a single-stranded DNA that mutated the 1370th G into A. Wherein, the sgRNA as shown in SEQ ID NO:1~2 makes CRISPR / Cas9 in the target site SEQ ID NO:8( tgg for the PAM region) to perform specific recognition and cleavage to form double-stranded DNA breaks (Double Strand Breaks, DSB), and promote homologous recombination repair of exogenous single-stranded DNA SEQ ID NO: 3 (ssODNA) as a template; CREBRFoligogo-g1 ( Both ends of SEQ ID NO:1) and CREBRFoligogo-g2 (SEQ ID NO:2) have BbsI restriction sites, the single-stranded DNA SEQ ID NO:3 is 86bp in length, with homology arms on both sides, at position 1370 G Replace it with A, and in order to prevent CRISPR / Cas9 from re-targeting the target site, a synonymous mutation is designed at the recognition site of t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides sgRNA, a CREBRF point mutation-type Bama miniature pig constructed by the sgRNA, and application. The sgRNA comprises a nucleic acid sequence as shown in SEQ ID NO: 1 or SEQ IDNO: 2. According to the invention, a scheme of combining CRISPR / Cas9 with homologous recombination is adopted, point mutation of CREBRF gene is carried out, the designed gRNA has specific binding property on a target site near the 1370th site of the CEREBRF gene, the CRISPR / Cas9 can be guided to carry out specific recognition cutting near the target site, double-stranded DNA breakage is formed, homologous recombination repair with exogenous single-stranded DNA as a template is promoted, and therefore the point mutation is introduced. The mutant Bama miniature pig prepared by the method has a typical obesity phenotype and can be used as a model organism to be applied to the field of research and development of medicines for treating obesity and diabetes.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to a sgRNA and a CREBRF dot-map variant Bamaxiang pig constructed by the same and an application thereof. Background technique [0002] In recent years, with the improvement of economic level and quality of life, the incidence of obesity and diabetes has increased significantly. These two diseases are affected by many factors such as environment and genetics. So far, there is no effective cure. [0003] In 2017, Naka et al. reported (Naka et al., A missense variant, rs373863828-A(p.Arg457Gln), of CREBRF and body mass index in Oceanic populations, Journal of Human Genetics (2017), 1–3), in 1370 of the human CREBRF gene A missense mutation is carried out at the base, and G is mutated to A, so that the 457th amino acid is mutated from arginine (Arg) to glutamine (Gln), that is, Rs373863828, people carrying this A allele point mutation ( Although homozygous or heterozygous) are obese, they a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/10C12N15/85C12N15/12A01K67/027A61K48/00A61P3/04A61P3/10
CPCC12N15/113C12N15/102C12N15/8509C07K14/4702A01K67/0275A61K48/005A61P3/04A61P3/10C12N2310/20C12N2800/107A01K2217/07A01K2227/108A01K2267/0362
Inventor 李莹莹樊娜娜赖良学
Owner GUANGZHOU INST OF BIOMEDICINE & HEALTH CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com