Check patentability & draft patents in minutes with Patsnap Eureka AI!

Primer probe assembly for prenatal noninvasive diagnosis of bilateral cup-shaped ear deformity, kit and application of kit

A technology of primer probes and kits, which is applied in the field of genes, can solve the problems of patients' mental and physical pain, and achieve the effects of improving detection accuracy, high sensitivity, and saving cost and time

Active Publication Date: 2020-03-10
深圳市科迈今美生物医疗有限公司
View PDF8 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] There is no special prenatal detection method for the diagnosis of bilateral goblet ear deformity in the traditional method, and surgical treatment can only be performed after birth, which brings both mental and physical pain to the patient

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer probe assembly for prenatal noninvasive diagnosis of bilateral cup-shaped ear deformity, kit and application of kit
  • Primer probe assembly for prenatal noninvasive diagnosis of bilateral cup-shaped ear deformity, kit and application of kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] A primer-probe assembly for prenatal non-invasive diagnosis of bilateral goblet ear deformities, which includes any one of the following primer sets and probe sets (1) to (4);

[0046] (1) primer set 1 and probe set 1;

[0047] The primer set 1 includes the following two primers: ①Primer F1: its nucleotide sequence is CACAAGTTCAAAAGGCACCC; ②Primer R1: its nucleotide sequence is TTAATGCGATCCGTGTCTCG;

[0048] The probe set 1 includes the following 1 probe: ①Probe P1: its nucleotide sequence is AGAATGTTCCAGATAGCCCCGAGC, its 5' end is marked with a fluorescent group, and its 3' end is marked with a quencher group;

[0049] Wherein, the volume ratio of the primer set 1 and the probe set 1 is 1:1, and in the primer set 1, the mass ratio of the primer F1 and the primer R1 is 1:1.

[0050] (2) primer set 2 and probe set 2;

[0051] The primer set 2 includes the following two primers: ①Primer F2: its nucleotide sequence is CTCCAGCTCCCTTTGATGTATAC; ②Primer R2: its nucleotide s...

Embodiment 2

[0063] Embodiment 2: Kit

[0064] A kit for prenatal non-invasive diagnosis of bilateral goblet ear deformity, the kit includes a primer probe set, an enzyme system and a reaction reagent.

[0065] The primer-probe set includes the primer set and probe set in any one of (1) to (4), such as primer set 1 and probe set 1 in (1), or (2) Primer set 2 and probe set 2, or primer set 3 and probe set 3 in (3), or primer set 4 and probe set 4 in (4).

[0066] Described enzyme system comprises: Tfl DNA polymerase and Stoffel fragment (purchasing manufacturer: Cetus company) preferably this enzyme system is the enzyme mixture of Tfl DNA polymerase and Stoffel fragment; More preferably, this enzyme system also comprises MMLV reverse Recording enzyme, that is, the enzyme system is an enzyme mixture of Tfl DNA polymerase, Stoffel fragment and MMLV reverse transcriptase.

[0067] Described reaction reagent comprises: (1) Tris-sulfuric acid; (2) MOPS damping fluid; (3) sodium citrate; (4) (N...

Embodiment 3

[0072] Embodiment 3: the preparation method of kit

[0073] Preparation of a kit for prenatal non-invasive diagnosis of bilateral goblet ear deformity: the various components described in Example 2 are packaged according to their concentration and required amount, it should be noted that the enzyme The system is to mix ①0.5ml of Tfl DNA polymerase with a concentration of 0.5-1unit and 0.5ml of Stoffel fragment with a concentration of 0.5-1unit, or ②0.5ml of Tfl DNA polymerase with a concentration of 0.5-1unit, and 0.5ml with a concentration of 0.5 -1 unit of Stoffel fragment and 0.5ml of MMLV reverse transcriptase at a concentration of 0.5-1 unit are mixed, mixed evenly, and then packaged. The mixture of these specific types of enzymes enhances the resistance to inhibitors of the whole system, so that more templates can be added to the fluorescent realtime-PCR kit constructed according to the present invention, so that it can be used to improve sensitivity.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a primer probe assembly for prenatal noninvasive diagnosis of bilateral cup-shaped ear deformity, a kit and an application of the kit. The primer probe assembly comprises a primer group containing four primers and a probe group containing four probes; the kit comprises the primer probe assembly, an enzyme system and reaction reagents; and the kit can be used for prenatal noninvasive diagnosis of bilateral cup-shaped ear deformity. According to the invention, a method capable of being used for prenatal diagnosis of bilateral cup-shaped ear deformity of a fetus is developed for the first time, and the method has the advantages of good specificity, high resolution, high sensitivity, accuracy and rapidness. The method has simple and convenient technical operation steps, causes no trauma and has an important application value.

Description

technical field [0001] The invention relates to the field of gene technology, in particular to a primer probe assembly, kit and application thereof for prenatal non-invasive diagnosis of bilateral goblet ear deformities. Background technique [0002] Congenital ear deformity is a common birth defect that affects the position and shape of the auricle. Abnormal development of ear cartilage often affects the shape and normal function of the ear. Epidemiological surveys show that about 5% of the samples in the population have different degrees of congenital ear developmental deformities, mainly including protruding ears, goblet ears and congenital microtia (or no ears). [0003] Goblet ear deformity is a kind of congenital ear deformity. It is a congenital malformation disease between protruding ears and microtia. The cartilage is curled and adhered, the crus of the helix is ​​displaced downward, the antihelix and its hind feet are flattened or even disappeared, the scaphoid be...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6883C12Q1/6851C12N15/11
CPCC12Q1/6883C12Q1/6851C12Q2600/156C12Q2600/166C12Q2521/101C12Q2521/107C12Q2563/107C12Q2545/113Y02A50/30
Inventor 张娇朱可赵驰
Owner 深圳市科迈今美生物医疗有限公司
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com