Nano-antibody combination for detecting carcino-embryonic antigen by double-antibody sandwich method
A double-antibody sandwich and nanobody technology, applied in the field of immunology, to achieve the effect of improved accuracy, low detection limit, and good matching degree
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0026] Example 1 Preparation of anti-CEA monovalent nanobody
[0027] Refer to Chinese invention patent application CN106749667A. The variable region sequence of the monovalent Nanobody is shown in SEQ ID NO.1.
Embodiment 2
[0028] Example 2. Preparation of anti-CEA bivalent nanobody
[0029] 2.1VHH1-LHC-VHH1-pMES4 vector construction:
[0030] Due to the longer hinge region (LHC) of the antibody, design two downstream primers and perform two rounds of PCR. The operation is as follows:
[0031] 2.1.1 The first round of PCR was performed using monovalent Nanobody DNA as a template, and the primer sequences were as follows:
[0032] 11F1: AACTGCAGGAGAGCGGTGGCGGTC
[0033] 11R1:CAAGTGACCGTTAGCAGCGAACCGAAAACCCCCGAAACC
[0034] GCAGCCGCAGCCTCAACCGCAACCGCAGCCG
[0035] The PCR reaction conditions and program are: 95°C for 5 minutes; 30 cycles of 95°C for 30 seconds, 55°C for 30 seconds, 72°C for 30 seconds; 72°C for 7 minutes. Use the agarose gel recovery kit to recover the band of about 300bp ( figure 1 : M is Trans 2K DNAMarker; 1 is negative control, 2-10 is the first round of PCR product).
[0036] 2.1.2 Use the recovered product of the first round of PCR as a template for the second round of ...
Embodiment 3
[0046] Example 3. Affinity testing of anti-CEA Nanobodies
[0047] 3.1 Chip antigen coupling: prepare CEA antigen with different pH sodium acetate buffer (pH 5.5, pH 5.0, pH 4.5, pH 4.0) to make 20 μg / mL working solution, and prepare 50 mM NaOH regeneration solution at the same time, use Biacore T100 The template method in the instrument of the protein interaction analysis system is used to analyze the electrostatic binding between the antigens at different pH conditions and the surface of the chip (GE Company), and the most neutral one is selected based on the signal increase of 5 times RL. The pH system and adjust the antigen concentration as the coupling conditions as needed. The chip was coupled according to the template method that comes with the instrument: select the blank coupling mode for channel 1, select the Target coupling mode for channel 2, and set the target to the designed theoretical coupling amount. The coupling process takes approximately 60 minutes.
[00...
PUM
Property | Measurement | Unit |
---|---|---|
molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap