Site-directed knock-in method of exogenous gene based on cas12a technology
A technology of exogenous genes and technology, which is applied in the fields of genomics and genetic engineering, can solve problems such as inaccurate integration and mutations at both ends of the joint, and achieve the effect of improving accuracy
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035]Embodiment 1 Cas12a-based MITI technology can improve the accuracy of fixed-point integration
[0036] In order to prove the effect of the cohesive ends produced by Cas12a on site-specific integration, two strategies were designed in this example: Cas12a HITI and Cas12a MITI. The difference between these two strategies is that the direction of the 5 bases at the far end of PAM is opposite. ( figure 1 , a and b). In the MITI strategy, the cohesive ends generated by Cas12a at the genomic target site and the target site of the donor vector are complementary. As a control experiment, the accuracy of the Cas9 HITI strategy was also tested ( figure 1 , c).
[0037] The pZGs vector was digested with NcoI (the pZGs vector was provided by Wu Sen’s research group at the School of Biology, China Agricultural University, see Wu S, Ying G, Wu Q, Capecchi MR (2008) A protocol for constructing gene targeting vectors: Generating knockout mice for the cadherin family andbeyond.Nat ...
Embodiment 2MI
[0039] Example 2MITI can achieve more efficient and accurate reporter gene labeling
[0040] In order to further compare the accuracy of Cas12 MITI and Cas9 HITI, this example uses the 2A-tdTomato reporter system to mark the continuously expressed CLTA gene (NCBI Gene ID: 1211) in HEK293T cells ( image 3 , a). The recognition sequence of Cas12a in the genome of the CLTA site is TTTCCACAGGGTGGCTTCTTCAGTGCAC, and the recognition sequence of Cas9 is GTGGCTTCTTCAGTGCACCAGCGG. First, respectively, from pPB-hNRAS G12V Plasmid (pPB-hNRAS G12V Plasmids were provided by Wu Sen's research group from the School of Biology, China Agricultural University. See Xu C, Qi X, Du X, et al(2017) piggyBac mediatesefficient in vivo CRISPR library screening for tumorigenesis in mice. ProcNatl Acad Sci U S A 114:722–727. https: / / doi.org / 10.1073 / pnas.1615735114) to get the PB linker and prokaryotic backbone part of the PB vector, to get the 3×FLAG part from the pX330 vector, to get the 3×FLAG part...
Embodiment 3
[0044] Example 3 Introducing two Cas12a recognition sites on the donor vector can exclude the random integration of the plasmid backbone
[0045] In order to avoid the random insertion of the plasmid backbone into the genome, which may cause serious gene silencing, we added a genome-targeted gene by enzyme-cut ligation behind the puromycin gene in the Cas12a MITI donor vector (D4) of CLTA. The recognition sequence (TTTCCACAGGGTGGCTTCTTCAGTGCAC) of the Cas12a with the same point sequence and opposite direction has obtained the D4.1 vector ( Figure 4 , a). Its CrRNA can still use the CrRNA array plasmid of CLTACas12a MITI. After the D4.1 donor vector, CLTA Cas12a MITI CrRNA array plasmid and pY010 vector were co-electrotransfected into HepG2 cells, after 5 days of Puro selection, 16 tdTomato-positive cell clones were picked. The results of PCR and sequencing showed that 10 of the 16 clones had the expected sequence at the 5′ junction ( Figure 4 , b and c), and there were 8 ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More