Unlock instant, AI-driven research and patent intelligence for your innovation.

A kind of protein nanoparticle carrying antitumor peptide and its preparation method and application

A nanoparticle and anti-tumor technology, which is applied in the field of protein nanoparticles carrying anti-tumor peptides and its preparation, can solve the problems of ineffective internalization and achieve good tumor treatment effects

Active Publication Date: 2022-03-15
BEIHUA UNIV
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to its hydrophilicity, it cannot be effectively internalized into tumor cells, so it must be coupled with a receptor or ligand in the cell-penetrating part, and enter the target cell through a receptor-independent and dependent mechanism in order to exert its potential. pro-apoptotic properties

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of protein nanoparticle carrying antitumor peptide and its preparation method and application
  • A kind of protein nanoparticle carrying antitumor peptide and its preparation method and application
  • A kind of protein nanoparticle carrying antitumor peptide and its preparation method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0047] In order to further illustrate the technical effect of the present invention, the present invention is specifically described below through examples.

[0048] The present invention is based on the pro-apoptotic properties of pro-apoptotic peptide (KLAK) and the property that small heat shock protein (HSP16.5) can self-assemble into nanocages under physiological conditions (0°C-70°C, pH 5-11) , to design and develop a nanocage drug-loading system loaded with KLAK peptide. The specific amino acid sequence of the designed HSP-KLAK nanoparticle is as follows: GPLGLAGKLAKLAKKLAKLAK.

[0049] Construction of pET25b-HSP16.5-KLAK expression vector:

[0050] Synthesize the DNA fragment corresponding to KLAK:

[0051] Upstream primers:

[0052] 5' CCCAAGCTTGGACCATTAGGATTAGCAGGAAAACTGGCGAAACTGGCGAAAAAACTGGCGAAACTGGCGAAAGCGGCCGCACTCGAGCGG 3';

[0053] Downstream primers:

[0054] 5' CCGCTCGAGTGCGGCCGCTTTCGCCAGTTTCGCCAGTTTTTTTCGCCAGTTTCGCCAGTTTTTCCTGCTAATCCTAATGGTCCAAGCTTGGG 3';...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
particle diameteraaaaaaaaaa
diameteraaaaaaaaaa
Login to View More

Abstract

The invention belongs to the technical field of biomedicine, and relates to a protein nanoparticle carrying an anti-tumor peptide and its preparation method and application; the preparation method is: according to the gene sequence of the pET25b(+)-HSP16.5 expression vector, synthesizing the pro-apoptotic peptide The single-stranded DNA sequence corresponding to the KLAK peptide, after the annealing treatment, the product and the carrier were subjected to HindⅢ and XhoI double enzyme digestion, the digested product was recovered from the gel, the KLAK sequence was connected to the carrier, and the ligated product was transformed into DH5a Escherichia coli competent, picked Shake the monoclonal colony overnight, extract the plasmid for sequencing; transform the correctly sequenced pET25b(+)-HSP-KLAK plasmid into BL21 Escherichia coli competent, expand the culture, sonicate the bacteria to obtain the corresponding crude product, then purify, dialyze and concentrate HSP-KLAK protein is obtained after freeze-drying; the heat shock protein nanoparticles carrying anti-tumor peptides of the present invention can be rapidly taken up by tumor cells, and after being released in lysosomes, target mitochondria to exert tumor-killing functions, while the protein of the drug carrier itself It can be rapidly degraded by cells to achieve a good therapeutic effect on tumors.

Description

technical field [0001] The invention relates to the technical field of biomedicine, in particular to a protein nanoparticle carrying an anti-tumor peptide and a preparation method and application thereof. Background technique [0002] Cancer, also known as malignant tumor, is a frequently-occurring disease caused by multiple factors, multiple gene mutations, and multi-stage development. The severe toxic side effects and multi-drug resistance of tumor cells during the clinical use of traditional chemotherapy drugs have severely limited Their use in tumor therapy. [0003] Peptides are small "proteins" composed of a small number of amino acids (10-100), which have the advantages of small molecular weight, easy modification, clear structure, clear mechanism of action, and activity close to that of proteins. They combine the advantages of chemical drugs and protein drugs, so It has become one of the hot spots in the research and development of anticancer drugs. [0004] Antitu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): A61K9/51A61K38/16A61K47/42A61P35/00C07K19/00C07K1/14C12N15/62C12N15/70C12N15/66
CPCA61K9/5169A61K9/0019A61K38/16A61P35/00C07K7/08C07K14/47C12N15/70C12N15/66C07K2319/00
Inventor 关新刚夏薇王冬梅
Owner BEIHUA UNIV