Unlock instant, AI-driven research and patent intelligence for your innovation.

Preparation and application of aptamer resisting potassium perfluorooctane sulfonate

A technology of potassium perfluorooctane sulfonate and nucleic acid aptamer, which is applied in the direction of biochemical equipment and methods, instruments, and analytical materials, and can solve problems such as expensive instruments and complicated operations

Active Publication Date: 2020-05-08
HUAQIAO UNIVERSITY
View PDF5 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, these methods involve expensive instruments, require specialized technicians, and are complicated to operate.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation and application of aptamer resisting potassium perfluorooctane sulfonate
  • Preparation and application of aptamer resisting potassium perfluorooctane sulfonate
  • Preparation and application of aptamer resisting potassium perfluorooctane sulfonate

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] 1) Design a random single-stranded library and combine it with downstream primers:

[0038] 5'-GCGCATACGAGCTTGTTCAATA (SEQ ID NO.05)

[0039] -N40-TGATAGTAAGTGCAATCTAGCC (SEQ ID NO.06)-3' and biotin-modified downstream primer Biotin-PR: Biotin-C6-GGCTAGATTGCACTTACTATCA-3' (SEQ ID NO.07), molar ratio 1:1~1:2 , optimize the ratio of 1:1.5 into a 200μL PCR tube, add an appropriate amount of binding buffer (5 × binding buffer containing 125mM Tris-HCl, 500mM NaCl, 125mMKCl, 50mM MgCl 2 , 5% DMSO, pH7.5) diluted to 1×bindingbuffer in a PCR tube to 200μL and mixed. Then put it in a PCR instrument: 95°C for 10 minutes, 4°C for 10 minutes, and slowly return to room temperature for annealing;

[0040] 2) Take 10 μL of streptavidin magnetic bead suspension (Thermo Fisher, USA) in a 1.5 mL centrifuge tube, add 200 μL of 1×binding buffer to wash, and let stand on the magnetic stand for 1 min, until no magnetic beads are suspended in the supernatant, Remove the supernatant and re...

Embodiment 2

[0056] 1) Pretreatment of nitrocellulose membrane: Use scissors to cut a few pieces of nitrocellulose membrane (only one sample) with a size of about 5 mm × 5 mm, put them on clean PE gloves that have been marked in advance, and use a pencil to mark the surface of the membrane. Mark the upper right corner as the site for tweezers to prevent large-scale contamination of the membrane, and use a 1mL syringe needle to position in the center of the membrane;

[0057] 2) Target immobilization: take 2.5 μL of sample (experimental group: target solution; primer control group: target solution; bindingbuffer control group: binding buffer) and place it in the center of the marked area of ​​the syringe, and apply additional samples after air-drying for the second time Leave it at room temperature for 1.5h;

[0058] 3) Membrane washing: Place the nitrocellulose membrane immobilized with the target in a 24-well plate (one membrane per well), add 1 mL washing buffer (binding buffer containin...

Embodiment 3

[0073] High-throughput sequencing and result analysis:

[0074] 1) In order to avoid errors in high-throughput sequencing caused by contamination, the samples were subjected to PCR amplification and electrophoresis before sequencing ( Figure 5 );

[0075] 2) The amplified sample was subjected to high-throughput sequencing (llumina, MiSeq2x300bp.), and analyzed from three aspects: sequence homology, secondary structure diversity and complexity, and three-dimensional structure molecular docking, and the sequence obtained from high-throughput sequencing 4 possible candidate sequences were selected from

[0076] PS1:

[0077] GCGCATACGAGCTTGTTCAATATGAGGCTTGTCGAATAACGTGTCTAATCGAGTCCCCGCCGTTGATAGTAAGTGCAATCTAGCC( Image 6 , SEQ ID NO.01)

[0078] PS36:

[0079] GCGCATACGAGCTTGTTCAATAATCGTGCTGTGCGCATACGAGCTTGTTCAATAGTGGTTGATAGTAAGTGCAATCTAGCC( Figure 7 , SEQ ID NO.02)

[0080] PS39:

[0081] GCGCATACGAGCTTGTTCAATATGAGGCTCGTCGAATAACGTGTCTAATCGAGTCCCCGCCGTTGATAGTAAGTGCAATCTAG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an aptamer for resisting potassium perfluorooctane sulfonate. The aptamer comprises at least one of PS1, PS36, PS39 and PS96, wherein the PS1 comprises a sequence as shown in SEQ ID NO.01, the PS36 comprises a sequence as shown in SEQ ID NO.02, the PS39 comprises a sequence as shown in SEQ ID NO.03, and the PS96 comprises a sequence as shown in SEQ ID NO.04. The aptamer canbe specifically combined with a persistent organic pollutant, potassium perfluorooctane sulfonate, and can be applied to a biosensor for detecting the potassium perfluorooctane sulfonate.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a nucleic acid aptamer resistant to potassium perfluorooctane sulfonate. Background technique [0002] Perfluorooctane sulphonate (PFOS) is a class of man-made organic substances that are not easy to decompose and persist in the environment. These substances are commonly called persistent organic pollutants (POPs). Because of its stable chemical structure and both hydrophobic and oleophobic properties, it is widely used in light water foam fire extinguishing agents, metal plating, fabric and leather production and other fields. Its harm has been paid more and more attention, including teratogenic carcinogenic mutagenicity, obvious bioaccumulation and amplification characteristics (Xie Y, Yang Q, Nelson B D, et al. Therelationship between liver peroxisome proliferation and adipose tissueatrophy induced by peroxisome proliferator exposure and withdrawal in mice[J].Biochemi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/115G01N33/53
CPCC12N15/115G01N33/5308C12N2310/16
Inventor 林俊生庄贞静雷云霞蒋灵丽
Owner HUAQIAO UNIVERSITY