Al technical title is built by PatSnap Al team. It summarizes the technical point description of the patent document.
A sars-cov-2, kit technology, applied in DNA/RNA fragments, recombinant DNA technology, microbial determination/inspection, etc., can solve the problem that it is difficult to achieve real-time detection of new coronavirus pneumonia on-site and without nucleic acid extraction. steps, unfavorable rapid detection and other problems, to avoid secondary pollution, low detection cost, and good specificity
Active Publication Date: 2020-06-12
GUANGDONG GENERAL HOSPITAL +1
View PDF1 Cites 10 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
[0003] (1) More than 90% of them are in the form of nucleic acid diagnostic kits, which need to be extracted, amplified and tested. The operation is cumbersome and requires professionals and complex P2 laboratories. It is difficult to realize the on-site detection of new coronavirus pneumonia (COVID-19) Real-time detection;
[0004] (2) Most of the qPCR methods are used, and the detection time is relatively long (about 4 hours) due to the heating and cooling cycles involved, which is not conducive to rapid on-site detection;
However, the isothermal amplification kits developed by the above companies have not yet achieved the step of exempting nucleic acid extraction.
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Image
Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
Click on the blue label to locate the original text in one second.
Reading with bidirectional positioning of images and text.
Smart Image
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1
[0050] This embodiment provides a closed SARS-CoV-2 isothermal amplification nucleic acid detection kit, the kit includes reaction premix A, reaction premix B, HNB chromogen, detection tube, standard positive template, negative control. The reaction premix consists of reaction premix A and reaction premix B. Wherein, the reaction premix A includes Bst DNA large fragment polymerase, AMV reverse transcriptase; the reaction premix B includes 10X reaction buffer, primer set, dNTPs, magnesium sulfate, betaine, 6wt% formamide and DEPC water.
[0051] The primer set includes a pair of outer primers F3-1 and B3-1, a pair of inner primers FIP-1 and BIP-1, and a pair of loop primers LF-1 and LB-1.
[0052] The nucleotide sequences of F3-1, B3-1, FIP-1, BIP-1, LF-1, LB-1 are as follows:
[0053] F3-1 (SEQ ID NO.1): 5'CTAGGTTTCAAACTTTACTTGC3';
[0054] B3-1 (SEQ ID NO.2): 5'CCTTTTTCTACAGTGAAGGATT3';
[0071] In combination with the requirements of the detection standards detected by the kit of the present invention, clinical verification has been carried out on the samples to be tested.
[0072] Comparison of LAMP test results with qPCR test
[0073]
[0074] LAMP positive detection rate for positive samples: 100%
[0075] LAMP positive detection rate for negative samples: 100%
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more
PUM
Login to view more
Abstract
The invention relates to the technical field of virus nucleic acid detection methods, and particularly relates to an RT-LAMP nucleic acid detection primer group of SARS-CoV-2 and a closed SARS-CoV-2 isothermal amplification nucleic acid detection kit. According to the kit provided by the invention, nucleic acid extraction is not needed for virus RNA of a throat swab sample, and the sample can be directly amplified. The kit is a visual instant screening kit for the SARS-CoV-2 by a one-step method. The kit has good specificity, can eliminate non-specific interference of other coronavirus strains, is quick and efficient, and can complete detection within one hour. Large expensive and precise instruments and equipment are not needed, only a common metal bath or water bath kettle is needed, detection cost is low, toxic reagents are not involved and closed operation is performed in the whole process, secondary pollution is avoided, and safety of operators and an environment is ensured.
Description
technical field [0001] The invention relates to the technical field of viral nucleic acid detection methods, in particular to a SARS-CoV-2 RT-LAMP nucleic acid detection primer set and a closed SARS-CoV-2 isothermal amplification nucleic acid detection kit. Background technique [0002] With the release of the "Diagnosis and Treatment Program for Pneumonia Infected by Novel Coronavirus (Trial Sixth Edition)", the importance of nucleic acid testing as an important standard for diagnosis has been generally recognized. However, nucleic acid detection involves extraction, amplification, detection, etc., and has high requirements for the laboratory environment and operators. A complete nucleic acid detection procedure for the new coronavirus often requires professional testers to operate with their hands off the platform for more than 3 hours in a row, involving large-scale Therefore, the popularization and on-site application of nucleic acid detection are limited, which leads to...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.
Login to view more 
Login to view more