Closed SARS-CoV-2 isothermal amplification nucleic acid detection kit

A sars-cov-2, kit technology, applied in DNA/RNA fragments, recombinant DNA technology, microbial determination/inspection, etc., can solve the problem that it is difficult to achieve real-time detection of new coronavirus pneumonia on-site and without nucleic acid extraction. steps, unfavorable rapid detection and other problems, to avoid secondary pollution, low detection cost, and good specificity

Active Publication Date: 2020-06-12
GUANGDONG GENERAL HOSPITAL +1
View PDF1 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] (1) More than 90% of them are in the form of nucleic acid diagnostic kits, which need to be extracted, amplified and tested. The operation is cumbersome and requires professionals and complex P2 laboratories. It is difficult to realize the on-site detection of new coronavirus pneumonia (COVID-19) Real-time detection;
[0004] (2) Most of the qPCR methods are used, and the detection time is relatively long (about 4 hours) due to the heating and cooling cycles involved, which is not conducive to rapid on-site detection;
However, the isothermal amplification kits developed by the above companies have not yet achieved the step of exempting nucleic acid extraction.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Closed SARS-CoV-2 isothermal amplification nucleic acid detection kit
  • Closed SARS-CoV-2 isothermal amplification nucleic acid detection kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] This embodiment provides a closed SARS-CoV-2 isothermal amplification nucleic acid detection kit, the kit includes reaction premix A, reaction premix B, HNB chromogen, detection tube, standard positive template, negative control. The reaction premix consists of reaction premix A and reaction premix B. Wherein, the reaction premix A includes Bst DNA large fragment polymerase, AMV reverse transcriptase; the reaction premix B includes 10X reaction buffer, primer set, dNTPs, magnesium sulfate, betaine, 6wt% formamide and DEPC water.

[0051] The primer set includes a pair of outer primers F3-1 and B3-1, a pair of inner primers FIP-1 and BIP-1, and a pair of loop primers LF-1 and LB-1.

[0052] The nucleotide sequences of F3-1, B3-1, FIP-1, BIP-1, LF-1, LB-1 are as follows:

[0053] F3-1 (SEQ ID NO.1): 5'CTAGGTTTCAAACTTTACTTGC3';

[0054] B3-1 (SEQ ID NO.2): 5'CCTTTTTCTACAGTGAAGGATT3';

[0055] FIP-1 (SEQ ID NO.3):

[0056] 5'CACATAATAAGCTGCAGCACCA-TACATAGAAGTTATTTGACTCC...

Embodiment 2

[0071] In combination with the requirements of the detection standards detected by the kit of the present invention, clinical verification has been carried out on the samples to be tested.

[0072] Comparison of LAMP test results with qPCR test

[0073]

[0074] LAMP positive detection rate for positive samples: 100%

[0075] LAMP positive detection rate for negative samples: 100%

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of virus nucleic acid detection methods, and particularly relates to an RT-LAMP nucleic acid detection primer group of SARS-CoV-2 and a closed SARS-CoV-2 isothermal amplification nucleic acid detection kit. According to the kit provided by the invention, nucleic acid extraction is not needed for virus RNA of a throat swab sample, and the sample can be directly amplified. The kit is a visual instant screening kit for the SARS-CoV-2 by a one-step method. The kit has good specificity, can eliminate non-specific interference of other coronavirus strains, is quick and efficient, and can complete detection within one hour. Large expensive and precise instruments and equipment are not needed, only a common metal bath or water bath kettle is needed, detection cost is low, toxic reagents are not involved and closed operation is performed in the whole process, secondary pollution is avoided, and safety of operators and an environment is ensured.

Description

technical field [0001] The invention relates to the technical field of viral nucleic acid detection methods, in particular to a SARS-CoV-2 RT-LAMP nucleic acid detection primer set and a closed SARS-CoV-2 isothermal amplification nucleic acid detection kit. Background technique [0002] With the release of the "Diagnosis and Treatment Program for Pneumonia Infected by Novel Coronavirus (Trial Sixth Edition)", the importance of nucleic acid testing as an important standard for diagnosis has been generally recognized. However, nucleic acid detection involves extraction, amplification, detection, etc., and has high requirements for the laboratory environment and operators. A complete nucleic acid detection procedure for the new coronavirus often requires professional testers to operate with their hands off the platform for more than 3 hours in a row, involving large-scale Therefore, the popularization and on-site application of nucleic acid detection are limited, which leads to...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/70C12Q1/6844C12N15/11C12R1/93
CPCC12Q1/701C12Q1/6844C12Q2531/119C12Q2521/107
Inventor侯铁英胡雪姣李杉吴际廖亚龙郑有为张雷
OwnerGUANGDONG GENERAL HOSPITAL