Supercharge Your Innovation With Domain-Expert AI Agents!

GL1 gene isolated from rice WZ1 and application of GL1 gene in increasing rice grain length

A gene and rice technology, applied in the application field of increasing rice grain length, can solve problems such as QTL phenotypic trait interference

Inactive Publication Date: 2020-06-19
HUAZHONG AGRI UNIV
View PDF6 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in the primary population, QTLs segregate simultaneously with many other non-QTL loci, and these non-QTL loci, like environmental factors, will have a great interference effect on the phenotypic traits of QTL

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • GL1 gene isolated from rice WZ1 and application of GL1 gene in increasing rice grain length
  • GL1 gene isolated from rice WZ1 and application of GL1 gene in increasing rice grain length
  • GL1 gene isolated from rice WZ1 and application of GL1 gene in increasing rice grain length

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] The discovery of the relationship between rice GL1 gene and rice grain length traits:

[0033] Screening process such as figure 1 As shown, the details are as follows:

[0034] 1) Initial mapping of GL1 gene:

[0035] Rice 9311 was crossed with WZ1 to obtain F1, and self-crossed to generate F2 random population. The grain length phenotype of the F2 population was investigated, and the extreme high and low pools were constructed. In the extreme pools, 10 plump seeds were selected for each plant, and the high and low pools were mixed to germinate. Two weeks later, take an equal amount of leaves from each plant and grind them with liquid nitrogen, and send them to China Seed Group (Wuhan) for 6K SNP chip detection;

[0036]Use the RiceVarMap database (http: / / ricevarmap.ncpgr.cn / ) to find the "variation ID" of the InDel polymorphic variation, and then use the "Design Primer by Variation ID" function to design the InDel marker. In design, it is preferred to select the In...

Embodiment 2

[0043] Application of GL1 gene of rice WZ1 in improving rice grain length:

[0044] 1) Design the PCR-specific primer GL1 ORF (table 1) with restriction endonuclease KpnI and EcoRI linker to amplify part of the GL1 gene of WZ1, the amplified sequence contains the sequence shown in SEQ ID NO.2, that is, in Add ATGACCATGATTACGAATTC to the 5' end of SEQ ID NO.2, and add GGTACCCGGGGATCCTCTAG to the 3' end. The Gibson ligation method (Gibson et al., 2009, Nat.Methods 6:343-345) was used to connect to pCAMBIA1301 to obtain the recombinant vector pCAMBIA1301-GL1-WZ1; using the transgenic method, the obtained correctly cloned plasmid was mediated by Agrobacterium The rice genetic transformation system was introduced into the rice variety Zhonghua 11 (the present invention or abbreviated as ZH11), and after induction, subculture, infection, co-cultivation, selection of hygromycin-resistant callus, differentiation, rooting, training The seedlings were transplanted to obtain transgenic ...

Embodiment 3

[0062] Comparative sequencing identifies natural variation among GL1 alleles

[0063] Sequencing of the GL1 target segment of 9311, WZ1 and ZH11 revealed that there were 36 polymorphic variations among varieties within the 2.3kb promoter and ORF range, 21 of which occurred in the 2.3kb upstream of the translation start site On the promoter, these mutations include substitution, insertion and deletion; 2 mutations occurred in exons; 4 mutations in introns; 9 mutations in 3'UTR.

[0064] In summary, GL1 WZ1 It is a major gene that positively regulates grain length and grain weight in rice. Since most of the variants in WZ1 appeared in 9311 or ZH11, except for a variant on a 3'UTR, it was preliminarily judged that the variant on the 3'UTR was likely to be the cause of the phenotypic change.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical fields of plant functional genomes and gene engineering, and particularly relates to a GL1 gene isolated from rice WZ1 and an application of the GL1 gene in increasing rice grain length. The applicants use a map-based cloning method to isolate and clone the major gene GL1 that controls the rice grain length from the rice variety WZ1, the sequence is shown inSEQ ID NO.1, after the gene is overexpressed in short-grain rice, the grain length and weight of the short-grain rice can be significantly increased, and novel genetic resources can be provided for rice yield and quality breeding.

Description

technical field [0001] The invention relates to the technical field of plant functional genome and genetic engineering, in particular to a GL1 gene isolated from rice WZ1 and its application in increasing rice grain length. Background technique [0002] Rice is one of the most important food crops and higher model organisms. Rice seed size (grain shape) is an important target trait for yield, appearance quality, domestication, breeding, and organ shape occurrence and development. At the same time, seed size contains key scientific issues such as yield and quality, seed (shape) occurrence and development, and Its research is in line with the national strategic needs. With the rise of molecular design breeding, this requires us to better discover grain shape genes. The isolation and cloning of genes that regulate seed size and the mining of functional genetic variation will not only help to enhance the understanding of the molecular regulation mechanism of seed size, provide...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C12N15/82A01H5/00A01H6/46
CPCC07K14/415C12N15/8261
Inventor 李一博张德建张春玉
Owner HUAZHONG AGRI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com