Treble fluorescent quantitation PCR reagent kit for detecting sea, seb and sec genes of staphylococcus aureus enterotoxins

A fluorescent quantitative and enterotoxin technology, applied in the field of bioengineering, can solve the problems of cumbersome procedures, unfavorable detection of a large number of samples, and high cost

Pending Publication Date: 2020-07-07
SHANGHAI ANIMAL EPIDEMIC PREVENTION & CONTROL CENT
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Aiming at the above-mentioned technical problems in the prior art, the present invention provides a triple fluorescence quantitative PCR kit for detecting the genes of Staphylococcus aureus enterotoxin sea, seb and sec, which is used for detecting Staphylococcus aureus enterotoxin The triple fluorescent quantitative PCR kit for the toxin sea, seb, and sec genes needs to solve the technical problems of the prior art kits for the detection of enterotoxin genes, such as long time, cumbersome procedures, and high cost, which are not conducive to the detection of a large number of samples

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Treble fluorescent quantitation PCR reagent kit for detecting sea, seb and sec genes of staphylococcus aureus enterotoxins
  • Treble fluorescent quantitation PCR reagent kit for detecting sea, seb and sec genes of staphylococcus aureus enterotoxins
  • Treble fluorescent quantitation PCR reagent kit for detecting sea, seb and sec genes of staphylococcus aureus enterotoxins

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] 1. Design and optimization of primers and probes

[0037] Sequence source: multiple sequences of S. aureus enterotoxin genes sea, seb, and sec were searched through the NCBI gene bank. Through sequence comparison, the following three sequences were finally selected for the design of primers and probes: the accession number of the representative strain of sea It is EF520720.1, the accession number of the seb representative strain is KX168632.1; the accession number of the sec representative strain is KX168615.1;

[0038] sea ​​extraction GenBank: EF520720.1.

[0039] atgaaaaaaacagcatttatactacttttattcattgccctaacgtggacaacaagtccacttgtaaatggtagcgagaaaagcgaagaaataaatgaaaaagatttgcgaaaaaagtctgaattgcagggaacagctttaggcaatcttaaacaaatctattattacaatgaaaaagctaaaactgaaaataaagagagtcacgatcaatttttacagcatactatattgtttaaaggcttttttacaaatcattcatggtataacgatttattagtagattttgattcaaaggatattgttgataaatataaagggaaaaaagtagacttatatggtgcttattatggttatcaatgtgcgggtggtacaccaaacaaaacagcttgcatgtatggtggtgtaacgtta...

Embodiment 2

[0065] Embodiment 2 standard curve test

[0066] The positive plasmids in the kit were taken, and their concentrations were determined to be 39.0ng / μL, 62.7ng / μL, and 36.2ng / μL, respectively. Use DEPC water to perform 10-fold gradient dilutions, and dilute 6 gradients in total, and perform qPCR detection for each dilution to obtain the slope and correlation coefficient R 2 value.

[0067] Experimental results: For the standard curve of the plasmid, see Figure 1-3 , the slopes are -3.2678, -3.4117, -3.3128 respectively, according to the formula E (amplification efficiency) = 10 -1 / 斜率 , converting the amplification efficiency into a percentage ((E-1)×100%) is 98.6%, between 90% and 110%, indicating that the amplification efficiency of this method is good; its R 2 The values ​​are 0.9992, 0.9982, 0.9998, respectively, between 0.99 and 1, indicating that the method has high reliability.

Embodiment 3

[0068] Embodiment 3 specificity test

[0069] The 14 standard strains in Table 3 were amplified and detected using two sets of enterotoxin triple qPCR systems, and the results showed that except for the positive strains (Staphylococcus aureus enterotoxin A ATCC 13565, Staphylococcus aureus Staphylococcus enterotoxin C ATCC 19095), other strains (Staphylococcus aureus CMCC26003, Staphylococcus aureus ATCC 29213, Micrococcus luteus CMCC 28001, Escherichia coli ATCC 25922, Pseudomonas aeruginosa ATCC 27853, pneumoniae Lebsiella ATCC700603, Salmonella paratyphi beta CMCC 50094, Candida albicans CMCC98001, Bacillus pumilus CMCC 63202, Bacillus subtilis CMCC 63501, Enterococcus faecalis ATCC 29212) had no amplification curves, and the designed primer probes had good specificity .

[0070] Table 3 Specific test strains

[0071]

[0072]

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a fluorescent quantitation PCR reagent kit for detecting enterotoxin genes sea, seb and sec. The fluorescent quantitation PCR reagent kit comprises Premix ExTaq, a primer, a probe, positive plasmids and sterilization water, wherein the sequences of the primer and the probe are as shown in SEQID No.1-9, a report fluorophore is marked at a 5' terminal of the probe, and a quenching fluorophore is marked at a 3' end of the probe. The invention also provides a method for detecting the enterotoxin genes sea, seb and sec through the reagent kit. Through the reagent kit disclosed by the invention, staphylococcus aureus enterotoxin genes sea, seb and sec can be rapidly detected, enterotoxins are subtyped, and a basis is provided for diagnosis of food poisoning.

Description

technical field [0001] The invention belongs to the field of bioengineering, and relates to a kit, in particular to a triple fluorescent quantitative PCR kit for detecting the genes of staphylococcus aureus enterotoxin sea, seb and sec. Background technique [0002] Staphylococcus aureus enterotoxin is a kind of extracellular protein with similar structure, virulence and different antigenicity, and it is the main factor causing food poisoning. According to reports, 1 μg / kg Staphylococcus aureus enterotoxin can cause vomiting, diarrhea and other symptoms. In the "Diagnostic Criteria, Judgment Principles and Treatment Principles of Staphylococcus Food Poisoning (WS / T80-1996)" it is stipulated that "Staphylococcus aureus was detected from poisoned food and patients' vomit and diarrhoea, and the strain was confirmed by enterotoxin detection. Only when the same type of enterotoxin is detected in different samples can it be determined that food poisoning caused by enterotoxin, so...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/686C12N15/11
CPCC12Q1/686C12Q2563/107C12Q2545/114C12Q2537/143
Inventor孙冰清姜芹张文刚顾欣黄士新商军吴剑平张浩然黄家莺张妤
OwnerSHANGHAI ANIMAL EPIDEMIC PREVENTION & CONTROL CENT