OX40 monoclonal antibody and application thereof
A monoclonal antibody and expression vector technology, applied in applications, antibodies, antibody medical components, etc., can solve the problems of low affinity and low specificity of mouse monoclonal antibodies.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1O
[0047] The production of embodiment 1OX40 monoclonal antibody
[0048]1.1. Construction and identification of pET32a(+)-OX40 recombinant plasmid
[0049] Using human full-length OX40cDNA as a template, upstream primer F: CATG CCATGG AACTCCACTGTGTCGGGGACACC, downstream primer R: CCC AAGCTT TTAGATGGCGGCAACCGCACG (the underlines are Noc I and Hind III restriction sites, respectively), to amplify the OX40 gene. PCR amplification program: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 50 s, annealing at 52°C for 35 s, extension at 72°C for 50 s, 29 cycles; extension at 72°C for 5 min. After electrophoresis and gel recovery, the PCR product was connected to the prokaryotic expression vector pET32a(+) and transformed into Escherichia coli BL21(DE3). Positive clones identified by Noc I and Hind III digestion were sent to Invitrogen for sequencing.
[0050] 1.2. Prokaryotic expression, identification and purification of OX40 protein
[0051] Inoculate the strains wi...
Embodiment 2O
[0058] Specificity and affinity of embodiment 2OX40 monoclonal antibody
[0059] 2.1. Detection of monoclonal antibody recognition of OX40 on the membrane surface by immunofluorescence
[0060] The cultured 293T cells were treated with 1×10 5 Cells / ml were seeded into 24-well plates with pretreated coverslips, and pLVX-IRES-ZsGreen and pLVXIRES-OX40-ZsGreen were transfected into 293T cells using liposomes, and placed in a CO2 incubator. Cultivate for 48h. Wash 3 times with ice-cold PBS, 5min each time. Fix with 3.7% paraformaldehyde at room temperature for 30 min, wash with PBS 3 times, 5 min each time. After sealed with 1% BSA at room temperature for 30 min, anti-OX40 monoclonal antibody diluted in 1% BSA was added, incubated at room temperature for 1 h, washed 3 times with PBS, 5 min each time. Add 1:400 diluted Dylight594-labeled goat anti-mouse secondary antibody and incubate at room temperature for 30 minutes, wash with PBS 3 times, 5 minutes each time. The slides we...
Embodiment 3
[0065] Example 3 Antibody Gene Variable Region Sequencing of OX40 Monoclonal Antibody Hybridoma Cells
[0066] Harvest monoclonal antibody 8F8 hybridoma cells in logarithmic growth phase, lyse with TRIZOL for RNA extraction, obtain cDNA after reverse transcription, amplify and obtain heavy and light chain variable regions, remove non-functional VK genes, and clone into The pMD18-T vector was sequenced, and the sequence results were compared using the IMGT / V-QUEST database for further analysis.
[0067] The base sequence of the heavy chain is shown in SEQ ID NO.1:
[0068] The amino acid sequence of the heavy chain variable region is shown in SEQ ID NO.2:
[0069] The base sequence of the light chain is shown in SEQ ID NO.3:
[0070] The amino acid sequence of the light chain variable region is shown in SEQ ID NO.4:
[0071] After comparison with the IMGT / V-QUEST database, the heavy chain:
[0072] CDR1-IMGT (SEQ ID NO.5):
[0073] CDR2-IMGT (SEQ ID NO. 6):
[0074] CDR3-...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap