Serum exosome miR-410-3p serving as acute cerebral infarction diagnosis marker and detection method thereof

Abstract

The invention provides application of a serum exosome miR-410-3p serving as an acute cerebral infarction diagnosis marker and a detection method thereof. The sequence of the serum exosome miR-410-3p is AATATAACACAGATGGCCTGT, and the serum exosome miR-410-3p is a biomarker for acute cerebral infarction diagnosis and treatment. The detection method of the serum exosome miR-410-3p comprises the following steps of collecting serum; separating exosomes in the serum, carrying out small RNA sequencing on the exosomes in the serum through Illumina to obtain a miRNAs expression profile, and carrying out bioinformatics analysis to screen differential expression miRNAs among samples; and analyzing the expression of the brain tissue specific miR-410-3p in serum exosomes of stroke patients and healthypeople by using a real-time fluorescent quantitative polymerase chain reaction technology. According to the research, the level of miR-410-3p in serum exosomes of stroke patients is remarkably increased (P is smaller than 0.001) compared with that of a control group, so that after acute cerebral infarction, brain tissue specificity miR-410-3p enters peripheral blood in an exosome form, and the level is remarkably increased compared with that of the control group; and therefore, the serum exosome can be used as acute cerebral ischemic injury diagnosis markers.

Description

technical field [0001] The invention belongs to the fields of biotechnology and medicine, and in particular relates to an application of serum exosome miR-410-3p as a diagnostic marker for acute cerebral infarction and a detection method thereof. Background technique [0002] Stroke is a relatively common disease of the nervous system, which has high morbidity, disability and mortality, and seriously endangers human health and quality of life. Currently, the only FDA-approved treatment for acute ischemic stroke is intravenous tissue plasminogen activator, which works by dissolving blood clots within 4.5 hours of stroke onset. However, due to the short treatment time window, only a small number of patients can receive this treatment, which greatly limits its clinical application. Therefore, early and accurate diagnosis of acute ischemic stroke is very important. In addition, for a long time, the early diagnosis of ischemic stroke mainly relied on clinical examination and va...

AI Technical Summary

Problems solved by technology

Although there have been many studies on circulating miRNAs as the diagnosis and prognosis of ischemic stroke, most of these miRNAs discovered so far lack

Images