Check patentability & draft patents in minutes with Patsnap Eureka AI!

Serum exosome miR-410-3p serving as acute cerebral infarction diagnosis marker and detection method thereof

A technology of diagnostic markers and detection methods, applied in the application and detection field of serum exosomal miR-410-3p, can solve the problems of lack of brain tissue specificity and no reliable diagnostic markers, and achieve accurate reflection. Effect

Pending Publication Date: 2020-08-14
NANTONG UNIVERSITY
View PDF3 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although there have been many studies on circulating miRNAs as the diagnosis and prognosis of ischemic stroke, most of these miRNAs discovered so far lack brain tissue specificity, and so far there is no reliable circulating miRNAs that can be used as a predictor of acute ischemic stroke. diagnostic markers

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Serum exosome miR-410-3p serving as acute cerebral infarction diagnosis marker and detection method thereof
  • Serum exosome miR-410-3p serving as acute cerebral infarction diagnosis marker and detection method thereof
  • Serum exosome miR-410-3p serving as acute cerebral infarction diagnosis marker and detection method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0032] In order to make the technical problems, technical solutions and advantages to be solved by the present invention clearer, the following will describe in detail with reference to the drawings and specific embodiments.

[0033] The present invention provides a serum exosomal miR-410-3p as a diagnostic marker for acute cerebral infarction. The sequence of the serum exosomal miR-410-3p is: AATATAACACAGATGGCCTGT.

[0034] The serum exosomal miR-410-3p provided by the present invention can be used as a biomarker for the diagnosis and treatment of acute cerebral infarction.

[0035] The present invention also provides a method for detecting serum exosomal miR-410-3p as a diagnostic marker for acute cerebral infarction, comprising the following steps:

[0036] (1) Collect serum;

[0037] (2) Isolate the exosomes in the serum, perform small RNA sequencing on the exosomes in the serum by Illumina, obtain the miRNAs expression profile, and perform bioinformatics analysis to scre...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides application of a serum exosome miR-410-3p serving as an acute cerebral infarction diagnosis marker and a detection method thereof. The sequence of the serum exosome miR-410-3p is AATATAACACAGATGGCCTGT, and the serum exosome miR-410-3p is a biomarker for acute cerebral infarction diagnosis and treatment. The detection method of the serum exosome miR-410-3p comprises the following steps of collecting serum; separating exosomes in the serum, carrying out small RNA sequencing on the exosomes in the serum through Illumina to obtain a miRNAs expression profile, and carrying out bioinformatics analysis to screen differential expression miRNAs among samples; and analyzing the expression of the brain tissue specific miR-410-3p in serum exosomes of stroke patients and healthypeople by using a real-time fluorescent quantitative polymerase chain reaction technology. According to the research, the level of miR-410-3p in serum exosomes of stroke patients is remarkably increased (P is smaller than 0.001) compared with that of a control group, so that after acute cerebral infarction, brain tissue specificity miR-410-3p enters peripheral blood in an exosome form, and the level is remarkably increased compared with that of the control group; and therefore, the serum exosome can be used as acute cerebral ischemic injury diagnosis markers.

Description

technical field [0001] The invention belongs to the fields of biotechnology and medicine, and in particular relates to an application of serum exosome miR-410-3p as a diagnostic marker for acute cerebral infarction and a detection method thereof. Background technique [0002] Stroke is a relatively common disease of the nervous system, which has high morbidity, disability and mortality, and seriously endangers human health and quality of life. Currently, the only FDA-approved treatment for acute ischemic stroke is intravenous tissue plasminogen activator, which works by dissolving blood clots within 4.5 hours of stroke onset. However, due to the short treatment time window, only a small number of patients can receive this treatment, which greatly limits its clinical application. Therefore, early and accurate diagnosis of acute ischemic stroke is very important. In addition, for a long time, the early diagnosis of ischemic stroke mainly relied on clinical examination and va...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6883C12Q1/6851C12N15/113
CPCC12Q1/6883C12Q1/6851C12Q2600/158C12Q2600/178C12Q2600/166C12Q2531/113C12Q2521/107C12Q2545/101
Inventor 季煜华周心季秋虹季菊玲
Owner NANTONG UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More