Tobacco mitogen-activated protein kinase gene ntmpk8 and its application
A protein kinase gene, mitogen activation technology, applied in the field of molecular biology, can solve the problem that there is no MAPK gene yet
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] Example 1: Tobacco Mitogen-Activated Protein Kinase Gene NtMAPK8 Cloning and sequence analysis of
[0026] In the present invention, the tobacco mitogen-activated protein kinase gene is obtained based on the sequencing of the tobacco whole genome and a large number of bioinformatics analysis and screening. NtMAPK8 ; Next, the tobacco mitogen-activated protein kinase gene was cloned using the tobacco whole genome cDNA as a template NtMAPK8 ,specifically:
[0027] 1. cDNA template preparation
[0028] Total RNA was extracted from fresh tissues of tobacco plants using reagents (Invitrogen, USA) following the manufacturer's instructions. Total RNA was reverse transcribed into cDNA using TransScript® One-Step gDNA Removal and cDNA Synthesis SuperMix (Quanshijin, China).
[0029] 2. PCR product amplification and recovery
[0030] Primers were designed with Primer5, and the primer sequences were as follows:
[0031] CDS-F: 5'-ATGGGAAGTTTCAGGAGATGCATGGAAATT-3' (represente...
Embodiment 2
[0043] Example 2 Characteristic analysis of the expression pattern of tobacco NtMAPK8 gene in different tissues
[0044]The expression patterns of NtMAPK8 gene in different tobacco tissues (roots, stems, leaves, flowers, etc.) were detected by fluorescence quantitative qRT-PCR. FastStart Universal SYBR Green Master (ROX) Realtime kit (Roche) was used. The relative quantitative method was used, the tobacco EF1α gene was used as the internal reference gene, and the template was the cDNA obtained from the above-mentioned different tissues. Three replicates were set for each sample, and a negative control and a positive control were set at the same time. The reaction system is shown in Table 1.
[0045] Table 1
[0046]
[0047] The two transcripts of the NtMAPK8 gene are MAPK8a and MAPK8b, respectively; qRT-PCR primer sequences:
[0048] NtMAPK8a-qRT-F: CGACCCAAAGGACCGACCCA is shown in SEQ ID NO: 10;
[0049] NtMAPK8a-qRT-R: CCTCAGGTCCTCCTTCGTCAC is shown in SEQ ID NO: 11;...
Embodiment 3
[0056] Example 3: Construction of gene editing vector
[0057] The target site of tobacco NtMAPK8 gene was designed by CRISPR / Cas9 gene editing technology to construct the NtMAPK8 gene knockout vector; the genetic transformation of tobacco varieties was carried out to obtain transgenic tobacco plants;
[0058] 1. Design target sites:
[0059] Target: GAGGCTAATGATGACTTGACA (as shown in SEQ ID NO: 7);
[0060] Synthetic plus linker sequence
[0061] Target-F: GATTGAGGCTAATGATGACTTGACA (as shown in SEQ ID NO: 8);
[0062] Target-R: AAACTGTCAAGTCATCATTAGCCTC (as shown in SEQ ID NO:9);
[0063] 2. Knockout vector construction
[0064] ① Single-stranded oligo DNA annealing to form double-stranded DNA
[0065] The synthesized two single-stranded primers (Target-F and Target-R) were diluted to 50 μmol / L, and then annealed. The annealing reaction system is shown in Table 2:
[0066] Table 2
[0067]
[0068] Incubate the reaction system at 95°C for 3 min in a PCR machine, and...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More