Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Novel aphid control agent, and method for controlling aphids through combined application of RNAi and beauveria bassiana

A technology of Beauveria bassiana and combined application, applied in the field of new aphid control agent, combined application of RNAi and Beauveria bassiana in the field of aphid control, can solve problems such as poor effect, and achieve the effect of a wide range of applications

Active Publication Date: 2020-08-25
SOUTHWEST UNIVERSITY
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The effect of using one of the control methods alone is not good, and there is no report of combining the two to control aphids

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Novel aphid control agent, and method for controlling aphids through combined application of RNAi and beauveria bassiana
  • Novel aphid control agent, and method for controlling aphids through combined application of RNAi and beauveria bassiana
  • Novel aphid control agent, and method for controlling aphids through combined application of RNAi and beauveria bassiana

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Based on the transcriptome sequencing data of pea aphid, the gene expression at three time points of Beauveria bassiana infection at 0h, 36h and 72h were analyzed, and the differentially expressed genes at different time points were compared and analyzed. Transcriptome sequencing of the pea aphid infected with Beauveria bassiana Bb07 obtained a total of 567 differential genes. These differentially expressed genes were annotated with NR. The results showed that most of the genes related to immunity and metabolism were up-regulated during 36h vs. 0h. Most of these genes were down-regulated during 72h vs 36h. Therefore, a total of 7 target genes were screened: Apgene4714, Apgene14740, Apgene14741, Apgene16968, Apgene15105, Apgene20844 and Apgene15782. Among them, Apgene4714 is an unidentified gene, which was significantly up-regulated at 36h and 72h; Apgene14740 and Apgene14741 are cathepsin genes, and KEGG analysis showed that they are involved in the lysosomal pathway; Ap...

Embodiment 2

[0031] Example 2 Pea aphid gene interference combined with Beauveria bassiana to control aphid 1. The synthesis of pea aphid dsRNA was performed as follows:

[0032] 1) According to the transcriptome data, use the aphid online database (https: / / bipaa.genouest.org / is / aphidbase / ) to obtain the cDNA sequence of the pea aphid (scientific name: Acyrthosiphon pisum) Apgene4714, Apgene20844 and Apgene15782 genes, and design to contain the T7 promoter The gene-specific primers of Apgene4714, Apgene20844, Apgene15782, the sequence of the upstream and downstream primers are:

[0033] T7-Apgene4714-S1 (SEQ ID NO:1):

[0034] TAATACGACTCACTATAGGGAAGACACCTAGTGGCTTGT;

[0035] T7-Apgene4714-A1 (SEQ ID NO: 2):

[0036] TAATACGACTCACTATAGGGTTGCAGCAGTGTTCAGATT;

[0037] T7-Apgene20844-S1 (SEQ ID NO: 3):

[0038] TAATACGACTCACTATAGGGGGCATTTAGCAAATCATAC;

[0039] T7-Apgene20844-A1 (SEQ ID NO: 4):

[0040] TAATACGACTCACTATAGGGCTGGTCGAGAATACACTTT;

[0041] T7-Apgene15782-S1 (SEQ ID NO: 5):

[0042] TAATACGACTCAC...

Embodiment 3

[0093] Example 3 Other gene interference test of pea aphid

[0094] The pea aphid Apgene14740, Apgene14741, Apgene16968 and Apgene15105 genes were also tested according to the method of Example 2. The corresponding dsRNA was synthesized and the experiment combination was set:

[0095] Apds14740 group: 1ml 0.05% Tween 80+1ml Apds14740 (2004ng / μl);

[0096] Apds14740+Bb07: 1ml Apds14740 (2004ng / μl) + 1ml spore suspension (2×10 9 Spore / mlBb07);

[0097] Apds14741 group: 1ml 0.05% Tween 80+1ml Apds14741 (2004ng / μl);

[0098] Apds14741+Bb07: 1ml Apds14741 (2004ng / μl) + 1ml spore suspension (2×10 9 Spore / mlBb07);

[0099] Apds15105 group: 1ml 0.05% Tween 80+1ml Apds15105 (2004ng / μl);

[0100] Apds15105+Bb07: 1ml Apds15105 (2004ng / μl) + 1ml spore suspension (2×10 9 Spore / mlBb07);

[0101] Apds16968 group: 1ml 0.05% Tween 80+1ml Apds16968 (2004ng / μl);

[0102] Apds16968+Bb07: 1ml Apds16968 (2004ng / μl) + 1ml spore suspension (2×10 9 Spores / mlBb07).

[0103] The experimental results are as Figure 4 A...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of pest control and genetic engineering, and discloses a novel aphid control agent. The novel aphid control agent comprises dsRNA of aphids and beauveria bassiana spores. The invention further discloses a method for controlling aphids through combined application of RNAi and beauveria bassiana. The novel aphid control agent is used for treating plants to prevent and control aphids. According to the invention, the novel aphid control agent is developed by combined application of biocontrol fungi and RNAi technology, and the aphid control agent has aremarkable synergistic mechanism, can overcome defects in controlling aphids by using fungi or the RNAi technology alone, and shows aphid control capability of up to 80%. The novel aphid control agentcan be directly sprayed on crops in a field so as to effectively prevent and treat aphids. The method is wide in application range; corresponding dsRNAs and spore suspension liquid of beauveria bassiana can be mixed together for spraying treatment only by synthesizing dsRNAs of different target genes of aphids; and the method can be widely applied to aphids such as pea aphids, peach aphids and brown citrus aphids.

Description

Technical field [0001] The present invention relates to the technical field of pest control and genetic engineering, in particular to a method for controlling aphids in combination with a novel aphid control agent, RNAi and Beauveria bassiana. Background technique [0002] The harm of aphids to plants includes two aspects: direct feeding and virus transmission. At present, the hazards and resistance of aphids are becoming more and more serious in production, and there is an urgent need to develop new aphid control strategies and technologies. Beauveria bassiana is a widely used biocontrol microorganism. It has the characteristics of a wide host range and strong prevention and control virulence. It has great application potential in pest control. Among them, Beauveria bassiana is the most widely used on corn borer and pine caterpillar. [0003] RNA interference (RNA interference, RNAi) is an important gene silencing method that has been widely used in recent years. It refers to th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A01N63/60A01N63/30A01N25/04A01P7/04A01G13/00
CPCA01G13/00A01N25/04A01N63/30A01N63/60
Inventor 王进军牛金志张君尚峰叶超张永军
Owner SOUTHWEST UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com