Novel aphid control agent, and method for controlling aphids through combined application of RNAi and beauveria bassiana
A technology of Beauveria bassiana and combined application, applied in the field of new aphid control agent, combined application of RNAi and Beauveria bassiana in the field of aphid control, can solve problems such as poor effect, and achieve the effect of a wide range of applications
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] Based on the transcriptome sequencing data of pea aphid, the gene expression at three time points of Beauveria bassiana infection at 0h, 36h and 72h were analyzed, and the differentially expressed genes at different time points were compared and analyzed. Transcriptome sequencing of the pea aphid infected with Beauveria bassiana Bb07 obtained a total of 567 differential genes. These differentially expressed genes were annotated with NR. The results showed that most of the genes related to immunity and metabolism were up-regulated during 36h vs. 0h. Most of these genes were down-regulated during 72h vs 36h. Therefore, a total of 7 target genes were screened: Apgene4714, Apgene14740, Apgene14741, Apgene16968, Apgene15105, Apgene20844 and Apgene15782. Among them, Apgene4714 is an unidentified gene, which was significantly up-regulated at 36h and 72h; Apgene14740 and Apgene14741 are cathepsin genes, and KEGG analysis showed that they are involved in the lysosomal pathway; Ap...
Embodiment 2
[0031] Example 2 Pea aphid gene interference combined with Beauveria bassiana to control aphid 1. The synthesis of pea aphid dsRNA was performed as follows:
[0032] 1) According to the transcriptome data, use the aphid online database (https: / / bipaa.genouest.org / is / aphidbase / ) to obtain the cDNA sequence of the pea aphid (scientific name: Acyrthosiphon pisum) Apgene4714, Apgene20844 and Apgene15782 genes, and design to contain the T7 promoter The gene-specific primers of Apgene4714, Apgene20844, Apgene15782, the sequence of the upstream and downstream primers are:
[0033] T7-Apgene4714-S1 (SEQ ID NO:1):
[0034] TAATACGACTCACTATAGGGAAGACACCTAGTGGCTTGT;
[0035] T7-Apgene4714-A1 (SEQ ID NO: 2):
[0036] TAATACGACTCACTATAGGGTTGCAGCAGTGTTCAGATT;
[0037] T7-Apgene20844-S1 (SEQ ID NO: 3):
[0038] TAATACGACTCACTATAGGGGGCATTTAGCAAATCATAC;
[0039] T7-Apgene20844-A1 (SEQ ID NO: 4):
[0040] TAATACGACTCACTATAGGGCTGGTCGAGAATACACTTT;
[0041] T7-Apgene15782-S1 (SEQ ID NO: 5):
[0042] TAATACGACTCAC...
Embodiment 3
[0093] Example 3 Other gene interference test of pea aphid
[0094] The pea aphid Apgene14740, Apgene14741, Apgene16968 and Apgene15105 genes were also tested according to the method of Example 2. The corresponding dsRNA was synthesized and the experiment combination was set:
[0095] Apds14740 group: 1ml 0.05% Tween 80+1ml Apds14740 (2004ng / μl);
[0096] Apds14740+Bb07: 1ml Apds14740 (2004ng / μl) + 1ml spore suspension (2×10 9 Spore / mlBb07);
[0097] Apds14741 group: 1ml 0.05% Tween 80+1ml Apds14741 (2004ng / μl);
[0098] Apds14741+Bb07: 1ml Apds14741 (2004ng / μl) + 1ml spore suspension (2×10 9 Spore / mlBb07);
[0099] Apds15105 group: 1ml 0.05% Tween 80+1ml Apds15105 (2004ng / μl);
[0100] Apds15105+Bb07: 1ml Apds15105 (2004ng / μl) + 1ml spore suspension (2×10 9 Spore / mlBb07);
[0101] Apds16968 group: 1ml 0.05% Tween 80+1ml Apds16968 (2004ng / μl);
[0102] Apds16968+Bb07: 1ml Apds16968 (2004ng / μl) + 1ml spore suspension (2×10 9 Spores / mlBb07).
[0103] The experimental results are as Figure 4 A...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com