Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A kind of method of controlling aphids by combined application of aphid control agent, RNAi and Beauveria bassiana

A technology for Beauveria bassiana and aphids, which is applied in the fields of pest control and genetic engineering, can solve problems such as poor results, and achieve a wide range of applications

Active Publication Date: 2021-11-30
SOUTHWEST UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The effect of using one of the control methods alone is not good, and there is no report of combining the two to control aphids

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of method of controlling aphids by combined application of aphid control agent, RNAi and Beauveria bassiana
  • A kind of method of controlling aphids by combined application of aphid control agent, RNAi and Beauveria bassiana
  • A kind of method of controlling aphids by combined application of aphid control agent, RNAi and Beauveria bassiana

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Based on the transcriptome sequencing data of the pea aphid, the gene expression at 0h, 36h and 72h of Beauveria bassiana infection was analyzed, and the differentially expressed genes at different time points were compared and analyzed. A total of 567 differentially expressed genes were obtained by sequencing the transcriptome of the pea aphid infected with Beauveria bassiana Bb07, and NR annotation was performed on these differentially expressed genes. Most of these genes were down-regulated at 72h vs 36h. Therefore, seven target genes were screened out: Apgene4714, Apgene14740, Apgene14741, Apgene16968, Apgene15105, Apgene20844 and Apgene15782. Among them, Apgene4714 was an unidentified gene, which was significantly up-regulated at 36h and 72h; Apgene14740 and Apgene14741 were cathepsin genes, and KEGG analysis showed that they were involved in the lysosomal pathway; , the insect epidermis is the first barrier; Apgene15105 belongs to the cytochrome P450 family gene,...

Embodiment 2

[0031] Example 2 Gene interference of pea aphids combined with Beauveria bassiana to control aphids

[0032] 1. Synthesis of dsRNA from pea aphid

[0033] Follow the steps below:

[0034] 1) According to the transcriptome data, use the aphid online database (https: / / bipaa.genouest.org / is / aphidbase / ) to obtain the cDNA sequences of the pea aphid (scientific name: Acyrthosiphon pisum) Apgene4714, Apgene20844 and Apgene15782 genes, and design T7 promoter Apgene4714, Apgene20844, Apgene15782 gene-specific primers, the sequences of the upstream and downstream primers are respectively:

[0035] T7-Apgene4714-S1 (SEQ ID NO: 1):

[0036] TAATACGACTCACTATAGGGAAGACACCTAGTGGCTTGT;

[0037] T7-Apgene4714-A1 (SEQ ID NO: 2):

[0038] TAATACGACTCACTATAGGGTTGCAGCAGTGTTCAGATT;

[0039] T7-Apgene20844-S1 (SEQ ID NO: 3):

[0040] TAATACGACTCACTATAGGGGGCATTTAGCAAATCATAC;

[0041] T7-Apgene20844-A1 (SEQ ID NO: 4):

[0042] TAATACGACTCACTATAGGGCTGGTCGAGAATACACTTT;

[0043] T7-Apgene15782-S...

Embodiment 3

[0096] Example 3 Other Gene Interference Tests of Pea Aphid

[0097] According to the method of Example 2, experiments were also carried out on the pea aphid Apgene14740, Apgene14741, Apgene16968 and Apgene15105 genes, the corresponding dsRNA was synthesized, and the experimental combination was set up:

[0098] Apds14740 group: 1ml 0.05% Tween 80+1ml Apds14740 (2004ng / μl);

[0099] Apds14740+Bb07: 1ml Apds14740 (2004ng / μl)+1ml spore suspension (2×10 9 spores / mlBb07);

[0100] Apds14741 group: 1ml 0.05% Tween 80+1ml Apds14741 (2004ng / μl);

[0101] Apds14741+Bb07: 1ml Apds14741 (2004ng / μl)+1ml spore suspension (2×10 9 spores / mlBb07);

[0102] Apds15105 group: 1ml 0.05% Tween 80+1ml Apds15105 (2004ng / μl);

[0103] Apds15105+Bb07: 1ml Apds15105 (2004ng / μl)+1ml spore suspension (2×10 9 spores / mlBb07);

[0104] Apds16968 group: 1ml 0.05% Tween 80+1ml Apds16968 (2004ng / μl);

[0105] Apds16968+Bb07: 1ml Apds16968 (2004ng / μl)+1ml spore suspension (2×10 9 spores / mlBb07).

[0...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical fields of pest control and genetic engineering, and discloses an aphid control agent: dsRNA comprising aphids and Beauveria bassiana spores; and also discloses a method for controlling aphids by combining RNAi and Beauveria bassiana, The plant is treated with the aphid control agent to prevent and control aphids. In the present invention, a new type of aphid control agent is developed through the combined application of biocontrol fungi and RNAi technology. The aphid control agent has a significant synergistic mechanism, can overcome the defects of using fungi or RNAi technology alone to control aphids, and can control aphids. 80%. The aphid control agent can be used to effectively prevent and control aphids by directly spraying crops in the field. The invention has a wide range of applications. It only needs to synthesize dsRNAs of different target genes of aphids, and then the corresponding dsRNAs can be mixed with the spore suspension of Beauveria bassiana and sprayed together. The method can be widely used in pea aphids and peach aphids and aphids such as the brown orange aphid.

Description

technical field [0001] The invention relates to the technical fields of pest control and genetic engineering, in particular to a method for controlling aphids through the combined application of an aphid control agent, RNAi and Beauveria bassiana. Background technique [0002] The harm of aphids to plants includes two aspects: direct feeding and virus transmission. At present, the harm and drug resistance of aphids are becoming more and more serious in production, and it is urgent to develop new strategies and technologies for aphid control. Beauveria bassiana is a widely used biocontrol microorganism, which has the characteristics of wide host range and strong control virulence, and has great application potential in pest control. Among them, Beauveria bassiana is most widely used on corn borers and pine caterpillars. [0003] RNA interference (RNA interference, RNAi) is an important gene silencing method that has been widely used in recent years. The phenomenon is that ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): A01N63/60A01N63/30A01N25/04A01P7/04A01G13/00
CPCA01G13/00A01N25/04A01N63/30A01N63/60
Inventor 王进军牛金志张君尚峰叶超张永军
Owner SOUTHWEST UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com