Application of fusion protein ifn-elp (v) in the preparation of drugs for preventing or treating glioblastoma
A glioblastoma and fusion protein technology, which is applied in the direction of peptide/protein components, drug combinations, anti-tumor drugs, etc., can solve the problems of no treatment, difficult resection, and difficult recurrence control, so as to reduce tumor recurrence and relieve cancer. Side Effects, Prognosis-improving Effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0056] In this example, a fusion protein particle of IFN-ELP(V) was constructed and expressed in E. coli, as follows:
[0057] The amino acid repeating unit of the ELP(V) sequence is: VGVPG (SEQ ID NO: 1), which is repeated 90 times in total.
[0058] Gene fragments containing repeat units and BseRI / AcuI cohesive ends were synthesized by Sangon Biotechnology (Shanghai, China).
[0059] Upstream snippet:
[0060] 5' GCGTGGGTGTTCCGGGCGTAGGTGTCCCAGGTGTGGGCGTACCGGGCGTTGGTGTTCCTGGTGTCGGCGTGCCGGGC3' (SEQ ID NO: 2)
[0061] Downstream snippet:
[0062] 5' TAGCCCGGCACGCCGACACCAGGAACACCAACGCCCGGTACGCCCACACCTGGGACACCTACGCCCGGAACACCCAC3' (SEQ ID NO: 3)
[0063] Insert into pET-25b(+) vector through BseRI / AcuI restriction site, and construct a plasmid with 18 repeating units as above by rolling circle method.
[0064] IFN gene sequence (NCBI GI 386795) was synthesized and inserted by Sangon Biotechnology (Shanghai, China) in the carrier. Using PCR technology, from The IFN coding ...
Embodiment 2
[0073] In this example, the IFN-ELP fusion protein obtained by culture in Example 1 was extracted and purified, as follows:
[0074] In this example, inverse transition cycling (ITC) was used to purify IFN-ELP(V). The specific method is as follows:
[0075] (1) Collect 1 L of E. coli culture solution in a centrifuge bottle, centrifuge at 3000×g to collect bacteria, and remove the upper culture solution.
[0076] (2) Resuspend the cells with 30 mL of ice-cold PBS, disrupt the cells by sonication at 4°C, and then centrifuge the disrupted product at 4°C under a centrifugal force of 14,000 × g for 15 minutes, and collect the supernatant.
[0077] (3) 2 mL of polyethyleneimine (PEI, 10%) was added to the supernatant collected in the previous step, and centrifuged again for 15 minutes to remove nucleic acids and other negatively charged substances in the cell lysate. For ITC purification: add NaCl with a final concentration of 3M, fully dissolve at 37°C and centrifuge at 14,000 × ...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com