Application of fusion protein ifn-elp (v) in the preparation of drugs for preventing or treating glioblastoma

A glioblastoma and fusion protein technology, which is applied in the direction of peptide/protein components, drug combinations, anti-tumor drugs, etc., can solve the problems of no treatment, difficult resection, and difficult recurrence control, so as to reduce tumor recurrence and relieve cancer. Side Effects, Prognosis-improving Effects

Active Publication Date: 2022-04-22
中山华梓生物科技有限公司
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although surgical techniques have made great progress, it is still difficult to completely resect, and even after combined radiotherapy and chemotherapy, its recurrence is still difficult to control
The currently recognized comprehensive treatment model of surgical resection combined with postoperative radiotherapy and chemotherapy has defects: 1. There is no treatment for a few weeks between surgery and subsequent radiotherapy and chemotherapy, and the residual tumor cells have begun to proliferate during this "treatment blank period" 2. The damaged blood-brain barrier still has a high selectivity, and the therapeutic drugs cannot effectively reach the central nervous system through systemic administration, thereby killing tumor cells
However, the short circulating half-life of IFNs greatly limits their application in GBM therapy

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of fusion protein ifn-elp (v) in the preparation of drugs for preventing or treating glioblastoma
  • Application of fusion protein ifn-elp (v) in the preparation of drugs for preventing or treating glioblastoma
  • Application of fusion protein ifn-elp (v) in the preparation of drugs for preventing or treating glioblastoma

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0056] In this example, a fusion protein particle of IFN-ELP(V) was constructed and expressed in E. coli, as follows:

[0057] The amino acid repeating unit of the ELP(V) sequence is: VGVPG (SEQ ID NO: 1), which is repeated 90 times in total.

[0058] Gene fragments containing repeat units and BseRI / AcuI cohesive ends were synthesized by Sangon Biotechnology (Shanghai, China).

[0059] Upstream snippet:

[0060] 5' GCGTGGGTGTTCCGGGCGTAGGTGTCCCAGGTGTGGGCGTACCGGGCGTTGGTGTTCCTGGTGTCGGCGTGCCGGGC3' (SEQ ID NO: 2)

[0061] Downstream snippet:

[0062] 5' TAGCCCGGCACGCCGACACCAGGAACACCAACGCCCGGTACGCCCACACCTGGGACACCTACGCCCGGAACACCCAC3' (SEQ ID NO: 3)

[0063] Insert into pET-25b(+) vector through BseRI / AcuI restriction site, and construct a plasmid with 18 repeating units as above by rolling circle method.

[0064] IFN gene sequence (NCBI GI 386795) was synthesized and inserted by Sangon Biotechnology (Shanghai, China) in the carrier. Using PCR technology, from The IFN coding ...

Embodiment 2

[0073] In this example, the IFN-ELP fusion protein obtained by culture in Example 1 was extracted and purified, as follows:

[0074] In this example, inverse transition cycling (ITC) was used to purify IFN-ELP(V). The specific method is as follows:

[0075] (1) Collect 1 L of E. coli culture solution in a centrifuge bottle, centrifuge at 3000×g to collect bacteria, and remove the upper culture solution.

[0076] (2) Resuspend the cells with 30 mL of ice-cold PBS, disrupt the cells by sonication at 4°C, and then centrifuge the disrupted product at 4°C under a centrifugal force of 14,000 × g for 15 minutes, and collect the supernatant.

[0077] (3) 2 mL of polyethyleneimine (PEI, 10%) was added to the supernatant collected in the previous step, and centrifuged again for 15 minutes to remove nucleic acids and other negatively charged substances in the cell lysate. For ITC purification: add NaCl with a final concentration of 3M, fully dissolve at 37°C and centrifuge at 14,000 × ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention belongs to the field of biomedicine, and specifically relates to the application of fusion protein IFN-ELP(V) in the preparation of drugs for preventing or treating glioblastoma, after the fusion protein IFN-ELP(V) is administered through the tumor cavity , can be obviously turbid and precipitate in the tumor cavity, form a drug reservoir and release interferon slowly and continuously, generate an in situ immune response, and inhibit tumor recurrence in the early stage. At the same time, the combination of postoperative chemotherapy and chemotherapy produces a synergistic anti-tumor effect, effectively improving the prognosis of patients. The invention fills the "treatment gap" between tumor (especially GBM) surgery and postoperative radiotherapy and chemotherapy, and provides the earliest postoperative intervention measures to reduce tumor recurrence.

Description

technical field [0001] The invention relates to the field of biomedicine, in particular to the application of fusion protein IFN-ELP(V) in the preparation of drugs for preventing or treating glioblastoma. Background technique [0002] Glioblastoma (GBM) is highly malignant and has a very poor prognosis. Although surgical techniques have made great progress, it is still difficult to completely resect it, and its recurrence is still difficult to control even after combined radiotherapy and chemotherapy. The currently recognized comprehensive treatment model of surgical resection combined with postoperative radiotherapy and chemotherapy has defects: 1. There is no treatment for a few weeks between surgery and subsequent radiotherapy and chemotherapy, and the residual tumor cells have begun to proliferate during this "treatment blank period" 2. The damaged blood-brain barrier still has high selectivity, and therapeutic drugs cannot effectively reach the central nervous system t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): A61K38/21A61K47/64A61K48/00A61P35/00A61K31/4188
CPCA61K38/21A61K47/64A61K48/005A61P35/00A61K31/4188A61K2300/00
Inventor 高卫平王贵怀梁平
Owner 中山华梓生物科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap