Supercharge Your Innovation With Domain-Expert AI Agents!

2019-nCoV nucleic acid isothermal amplification primer based on molecular beacon, molecular beacon, test kit and detection method

A 2019-ncov and molecular beacon technology, which is applied in the fields of biochemical equipment and methods, microbial measurement/inspection, and resistance to vector-borne diseases, etc. more demanding questions

Pending Publication Date: 2020-10-27
HANGZHOU YORK BIOTECH CO LTD
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the relatively high price of the current PCR instrument, this condition is basically available in the laboratories of the top three hospitals, and the technical requirements for operators are relatively high, so it cannot be popularized and used at the grassroots level
In the case of a large-scale outbreak, it is impossible to efficiently screen a large area of ​​people

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • 2019-nCoV nucleic acid isothermal amplification primer based on molecular beacon, molecular beacon, test kit and detection method
  • 2019-nCoV nucleic acid isothermal amplification primer based on molecular beacon, molecular beacon, test kit and detection method
  • 2019-nCoV nucleic acid isothermal amplification primer based on molecular beacon, molecular beacon, test kit and detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0047] Embodiment: A primer and a molecular beacon described in this embodiment, the detection site includes the ORF1ab gene and the N gene of the 2019-nCoV virus, and the ORF1ab gene primer sequence is such as ORF1ab-F (SEQ ID NO.1) and Shown in ORF1ab-R (SEQ ID NO.2); The N gene primer sequence is shown in N-F (SEQ ID NO.3) and N-R (SEQ ID NO.4); The ORF1ab gene molecular beacon probe is shown in ORF1ab-P (SEQ ID NO.5), the N gene molecular beacon probe is shown as N-P (SEQ ID NO.6).

[0048] The primer sequence list is:

[0049] ORF1ab gene primer sequence: ORF1ab-F:

[0050] TAATACGACTCACTATAGGGCCCTGTGGGTTTTACACTTA (SEQ ID NO. 1);

[0051] ORF1ab gene primer sequence: ORF1ab-R:

[0052] TAATACGACTCACTATAGGGACGATTGTGCATCAGCTG (SEQ ID NO. 2);

[0053] N gene primer sequence: N-F:

[0054] TAATACGACTCACTATAGGGACATTGGCACCCGCAAT (SEQ ID NO. 3);

[0055] N gene primer sequence: N-R:

[0056] TAATACGACTCACTATAGGGGAGGAACGAGAAGAGGC (SEQ ID NO. 4);

[0057] ORF1ab Gene Molec...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a 2019-nCoV nucleic acid isothermal amplification primer based on a molecular beacon, the molecular beacon, a test kit and a detection method. The 2019-nCoV virus primer comprises an ORF1ab gene primer sequence and an N gene primer sequence of a 2019-nCoV virus; the molecular beacon comprises an ORF1ab gene molecular beacon probe and an N gene molecular beacon probe; the test kit comprises the 2019-nCoV virus primer, a molecular beacon, an NASBA amplification buffer solution and an NASBA enzyme mixed solution, the detection method using the test kit comprises the following steps: firstly, preparing an NASBA amplification buffer solution, preparing an NASBA enzyme mixed solution, preparing a primer mixed solution, and preparing an RNA sample; mixing, reacting and incubating all the solutions, and finally completing detection through a fluorescence detector. The invention shows high-specificity and high-sensitivity detection performance, and a large amount of experiment time is saved.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a primer and analytical beacon, a kit and a detection method for rapidly detecting 2019-nCoV virus based on constant temperature amplification technology and molecular beacon technology. Background technique [0002] At present, the more commonly used laboratory diagnostic techniques can be divided into virus cell culture techniques, imaging examinations, electron microscopy examinations, serological examinations, and molecular biological examinations. Among them, virus cell culture isolation is currently the most accurate method, but lacks the sensitivity and speed required for high-throughput screening, which may lead to delays in disease progression; serological methods such as ELISA have low specificity and cannot be diagnosed. Molecular biology detection method is now most common with qRT-PCR method, which has the advantages of high sensitivity, good specificity, wid...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/6844C12N15/11
CPCC12Q1/701C12Q1/6844C12Q2521/107C12Q2531/143C12Q2525/307C12Q2563/107C12Q2521/327Y02A50/30
Inventor 朱友杰孔繁平
Owner HANGZHOU YORK BIOTECH CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More