Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of long-chain non-coding RNA LINC01141 in preparation of pharmaceutical composition for treating liver cancer

A LINC01141, long-chain non-coding technology, applied in the field of biomedicine, can solve the problems of RNA forming protein and having no function, and achieve the effect of improving survival rate and excellent diagnostic value

Active Publication Date: 2020-11-06
CELLYAN THERAPEUTICS WUHAN CO LTD
View PDF1 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Only a small number of genes in the human genome can encode proteins, and 98% of the genes can be transcribed to form RNA, but these RNAs cannot further form proteins. The RNA formed by the transcription of these genes is called non-coding RNA. Before, people Treating these noncoding RNAs as transcriptional noise with no actual specific function

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of long-chain non-coding RNA LINC01141 in preparation of pharmaceutical composition for treating liver cancer
  • Application of long-chain non-coding RNA LINC01141 in preparation of pharmaceutical composition for treating liver cancer
  • Application of long-chain non-coding RNA LINC01141 in preparation of pharmaceutical composition for treating liver cancer

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Detection of the expression of LINC01141 in liver cancer tissues and adjacent tissues

[0030] 1. Research object

[0031] A total of 20 liver cancer tissues and corresponding paracancerous tissues were selected for the experiment. The tissues were obtained from Qingdao Cancer Hospital. All tissue samples were reviewed and approved by the Hospital Ethics Committee, and all patients who obtained the tissue samples signed informed consent. The liver cancer tissue was confirmed to be liver cancer by pathological examination (when the liver cancer tissue was resected, the patient had not yet received chemotherapy, radiotherapy, etc.).

[0032] The specific specimens are as follows:

[0033]

[0034]

[0035] 2. Tissue RNA Extraction

[0036] (1) Take out the tissue sample from the -80°C refrigerator, take about 50 mg of the tissue sample and put it into a mortar, add a small amount of liquid nitrogen, and grind it quickly. After the tissue becomes soft, add a small ...

Embodiment 2

[0080] Knockdown of the LINC01141 gene

[0081] 1. siRNA design

[0082] si-RNA-1

[0083] 5'‐AUUUUGCAGAUCUAUCAUCCU‐3' (SEQ ID NO.6)

[0084] 5'-GAUGAUAGAUCUGCAAAAUUC-3' (SEQ ID NO.7)

[0085] si-RNA-2

[0086] 5'‐AUCAAGUAUCUAUAUGUGCCA‐3' (SEQ ID NO.8)

[0087] 5'-GCACAUAUAGAUACUUGAUAC-3' (SEQ ID NO.9)

[0088] si-RNA-1 and si-RNA-2 were synthesized by Shanghai Gemma Company, and si-NC was provided by the company.

[0089] 2. Cell culture

[0090] Human liver cancer cells HepG2 were cultured in high-glucose DMEM medium (10% fetal bovine serum), culture conditions: cell constant temperature incubator at 37°C, 5% CO 2 .

[0091] 3. siRNA transfection

[0092] (1) The day before transfection, 2×10 5 HepG2 cells were seeded on 6-well cell culture plates at 37°C, 5% CO 2 After culturing in the incubator for 24 hours, the cells were transfected according to the instructions of Lipofectamine 2000;

[0093] (2) The experimental groups were divided into control group (empty...

Embodiment 3

[0103] 1. Cell Proliferation Experiment

[0104] (1) Divide 5×10 3 HepG2 cells transfected with si-NC and si-RNA-1 were inoculated in a 96-well plate, 90 μl per well, with 3 replicate wells for each group, placed at 37°C, 5% CO 2 cultured in a cell culture incubator;

[0105] (2) Test at 24h, 48h, and 72h respectively. When testing, add 10ul of CCK-8 detection solution to each well, and then place it in a 37°C, 5% CO2 incubator for 4 hours;

[0106] (3) Place the cell culture plate in a microplate reader, detect the absorbance at 450nm, and draw the growth curve.

[0107] 2. Results

[0108] pass Figure 4 It can be seen that after the experimental group was transfected with si-RNA-1, compared with the si-NC group, the proliferation of HepG2 cells was inhibited, and the proliferation rate was significantly reduced. At 72h, the OD value of the si-NC group was 1.09± 0.049, and the OD value of the si-RNA-1 group was 0.766±0.041, the difference was statistically significant, ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides application of long-chain non-coding RNA LINC01141 in preparation of a liver cancer treatment pharmaceutical composition, and belongs to the technical field of biological medicines. Experiments find that cell proliferation of liver cancer cells can be remarkably inhibited by inhibiting LINC01141 through siRNA, so that siRNA can be used for preparing a novel treatment medicine for treatment liver cancer patients and has important clinical value and application prospect.

Description

[0001] This case is a divisional application. The invention name of the original application is: a long non-coding RNA gene marker for detecting liver cancer and its application. The filing date of the original application is: 2020-03-20, and the application number of the original application is : 202010200141.3. technical field [0002] The invention belongs to the technical field of biomedicine, and in particular relates to the application of long-chain non-coding RNA LINC01141 in the preparation of a pharmaceutical composition for treating liver cancer. Background technique [0003] Liver cancer is one of the most common cancers in clinical practice. The annual death rate of liver cancer ranks third among malignant tumors in the world, and the new incidence rate ranks fifth among malignant tumors in the world, and the occurrence of liver cancer shows a trend of rapid increase. The pathogenesis of liver cancer is related to viral infection, non-alcoholic fatty liver, alco...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12Q1/6886A61K31/713A61P1/16A61P35/00
CPCA61K31/713A61P1/16A61P35/00C12N15/113C12Q1/6886C12Q2600/158C12Q2600/178
Inventor 曹爱华
Owner CELLYAN THERAPEUTICS WUHAN CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products