Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Preparation method, epitope identification and application of porcine CD163 protein monoclonal antibody

A CD163, antigen epitope technology, applied in the field of biology, can solve the problem of limited protection ability of heterotype PRRSV

Active Publication Date: 2020-12-11
SHANGHAI VETERINARY RES INST CHINESE ACAD OF AGRI SCI
View PDF5 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

PRRSV has an antibody-dependent enhancement effect, and its antigen is highly variable. The vaccine has an effective effect in protecting the same type of PRRSV, but the protection ability against heterotype PRRSV is limited. In-depth research on the mechanism of PRRSV will do a better job for us. The prevention and control of PRRSV provides theoretical support

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method, epitope identification and application of porcine CD163 protein monoclonal antibody
  • Preparation method, epitope identification and application of porcine CD163 protein monoclonal antibody
  • Preparation method, epitope identification and application of porcine CD163 protein monoclonal antibody

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0019] Example 1 Construction of CD163 protein antigen

[0020] In order to obtain CD163 protein monoclonal antibody Mab, the inventor first constructed the full-length CD163 prokaryotic expression plasmid and CD163 SRCR5-6 prokaryotic expression plasmid, the inventor first designed primers for CD163-51-1116aa and CD163 SRCR5-6, and invented The primers designed by humans are as follows:

[0021] CD163-51-1116aa-F: 5- CTCGAGGGATCCGAA ATGCTGAGGCTAACGGGTGGTG-3 (SEQ ID NO. 2)

[0022] CD163-51-1116aa-R:5- GTCGACAAGCTTGAATT TCATTGTACTTCAGAG-3 (SEQ ID NO. 3)

[0023] CD163 SRCR5-6-F:5- TCGGTACCCTCGAGGGA ATGCCCAGGCTGGTTGGAGGGGAC-3 (SEQ ID NO. 4)

[0024] CD163 SRCR5-6-R:5- AGCTTGAATTCGGATC TCATGAGCAGATTACAGAGGCCAC 3 (SEQ ID NO. 5)

[0025] The above primers were all porcine CD163-specific sequences by BLAST analysis, and the primers were synthesized by Sunny Bio Shanghai Company. Using porcine alveolar macrophage cDNA (GenBank NO: EU016226.1) as a template for PCR amplif...

Embodiment 2

[0027] Example 2 Induced expression and purification of CD163 protein

[0028] Transform the above-mentioned constructed plasmid into BL21(DE)3 competent medium, pick colonies and culture them at 37°C, when the bacterial liquid grows to about OD 0.4~0.6, add 1mM IPTG, induce expression at 16°C for 12 hours, use lysis Buffer (10 mMimidazole, 20 mM sodium phosphate, 0.5 M NaCl, pH 7.4) resuspended bacteria liquid, sonicated the bacterial liquid, and centrifuged at 10,000 rpm / min for 10 min to obtain the supernatant and precipitate, and took an appropriate amount of samples for SDS-PAGE. Massie brilliant blue staining was used to identify the expression of CD163 protein. The results showed that the expression level of full-length CD163 protein was low, and the expression level of CD163 SRCR5-6 protein in the precipitate was high, so the CD163 SRCR5-6 antigen in the precipitate was purified by urea gradient purification ( figure 2). The specific steps are as follows: dissolve t...

Embodiment 3

[0029] Example 3 Animal Immunization

[0030] The protein purified by the above method has a good concentration of purity. Mix and emulsify the purified protein with an equal volume of Freund's complete adjuvant, subcutaneously immunize 6-week-old Balb / c mice (100ng / only), and two weeks later For the second immunization, the purified protein was fully mixed and emulsified with an equal volume of Freund's incomplete adjuvant, and 6-week-old Balb / c mice (100ng / mouse) were subcutaneously immunized, and then three immunizations were performed two weeks later. One week after the third immunization, the whole blood of Balb / c mice was collected from the eyeball, the serum was naturally separated, and the antibody titer in the serum was determined by indirect ELISA (96-well ELISA reaction plate coated with recombinant protein antigen, each well coated with 200ng antigen ), the mouse with the highest serum titer was taken for the next cell fusion experiment. In order to increase the t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to a preparation method, an epitope identification and an application of a CD163 protein monoclonal antibody MAb. A functional structural domain SRCR5-6 with an importanteffect on PRRSV replication of CD163 is cloned into a pColdI vector, CD163 SRCR5-6 protein carrying His labels in a prokaryotic expression vector is constructed, the SRCR5-6 protein is purified to immunize Balb / c mice, spleen cells of mice and myeloma SP2 / 0 cells are taken to prepare hybridoma cells to obtain an anti-porcine CD163 protein monoclonal antibody, and besides, the antibody is subjected to the epitope identification.

Description

technical field [0001] The invention relates to the field of biology, and specifically provides a preparation method, epitope identification and application of porcine CD163 monoclonal antibody MAb. Background technique [0002] Porcine reproductive and respiratory syndrome is an important infectious disease that endangers the pig industry, and its pathogen is porcine reproductive and respiratory syndrome virus. PRRSV has an antibody-dependent enhancement effect, and its antigen is highly variable. The vaccine has an effective effect in protecting the same type of PRRSV, but the protection ability against heterotype PRRSV is limited. In-depth research on the mechanism of PRRSV will do a better job for us. The prevention and control of PRRSV provides theoretical support. [0003] PRRSV has strict cell tropism, and cell surface receptors play an important role in the process of PRRSV infection. Currently known PRRSV receptors include CD163, heparan sulfate, sialoadhesin, CD15...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/705C07K16/28C07K16/06A61K39/395A61P31/14G01N33/68G01N33/569G01N33/577
CPCC07K14/70596C07K16/2896C07K16/065A61P31/14G01N33/6872G01N33/56983G01N33/577C07K2317/34G01N2333/70596
Inventor 高飞张玉娇童光志郑浩李丽薇虞凌雪姜一峰童武张宽
Owner SHANGHAI VETERINARY RES INST CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com