Saccharopolyspora spinosa capable of highly yielding spinosad and method for increasing spinosad yield of strain
A technology of Saccharopolyspora spinosa and spinosad, applied in the biological field, can solve the problems of difficult industrialized production, low fermentation yield, hindered industrialization of multi-killing strains, etc., and achieves the effects of stable and optimized yield and increased yield
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] Example 1 Insertion of phiC31attB site in wild-type strain J1-019
[0031] (1) Construction of recombinant plasmid pYX204
[0032] The phiC31attB sequence with only 51 bp was designed on the relevant primers, using the genome of Saccharopolyspora spinosa J1-019 as a template, the upstream primer 5'-GTGCCAAGCTTGCCTCGCTGAGCCCGTAGGAGTTGATCAC-3', the downstream primer 5'-GGTGGAGTACGCGCCCGGGGAGCCCAAGGGCACGCCCTGGCACCCGCACCGGCCGCCGCGGGCAACGACGCGG'PCRCAG Left homology arm sequence, upstream primer 5'-CGGTGCGGGTGCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCGTACTCCACCCGTCGATTCCTCGGGTAGGGCGCAG-3', downstream primer 5'-CGCGCGCGGCCGCTGGTGACCGGCCACGCGCTGGTC-3' to amplify the right homology arm sequence, recover the left and right homology arm gels and use OE-PCR method Ligated, the ligated fragments were digested with HindIII / NotI double enzymes, recovered and connected to the vector pOJ260 plasmid that had been digested with HindIII / NotI double enzymes, and the sequencing results showed that the c...
Embodiment 2
[0047] Example 2 Construction of overexpressing spnJ and spnP strains in 019-A strains
[0048] (1) Construction of plasmid pIB139-spnJ, pIB139-spnP
[0049] The inventors used the attB-attP site for integration, and selected the promoter ermEp to overexpress spnJ and spnP respectively. Using the extracted genomic DNA of Saccharopolyspora spinosa J1-019 as a PCR template, use the cloned fragment spnJ primers (upstream primer: 5'-ACGCCATATGATGATCTCGGCTGCGGGCGAACAAAG-3', downstream primer: 5'-GCGCGCGGCCGCTCATGGCTGACCGGGTGAAAGCCGTG-3') to amplify the size of The 1642bp target band spnJ was cloned with spnJ primers (upstream primer: 5'-ACGCCATATGGTGATTCTTGGCATGCTTCCCG-3', downstream primer: 5'-GCGCGCGGCCGCTCACGGATGGCCATCAGACTGC-3') to amplify the 1368bp target spnP, and the target strip The band and the pIB139 plasmid were digested with NdeI / NotI at the same time and then ligated with T4 ligase. After one of the plasmids identified by enzyme digestion was correctly sequenced, the...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap