Saccharopolyspora spinosa capable of highly yielding spinosad and method for increasing spinosad yield of strain

A technology of Saccharopolyspora spinosa and spinosad, applied in the biological field, can solve the problems of difficult industrialized production, low fermentation yield, hindered industrialization of multi-killing strains, etc., and achieves the effects of stable and optimized yield and increased yield

Inactive Publication Date: 2020-12-22
WUHAN UNIV
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, although the wild-type transformation of this strain is relatively easy, there are also reports on the transformation of the wild-type strain of this strain, but because the fermentation yield of the wild-type strain is very low, it is difficult to apply it to industrial production even if the yield is improved after transformation.
For the production strain of S. spinosyn that has undergone multiple rounds of mutagenesis, its genetic manipulation is almost infeasible. Therefore, the industrialization of the spinosad strain is seriously hindered. It can accelerate the industrialization process of spinosad fermentation

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Saccharopolyspora spinosa capable of highly yielding spinosad and method for increasing spinosad yield of strain
  • Saccharopolyspora spinosa capable of highly yielding spinosad and method for increasing spinosad yield of strain
  • Saccharopolyspora spinosa capable of highly yielding spinosad and method for increasing spinosad yield of strain

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1 Insertion of phiC31attB site in wild-type strain J1-019

[0031] (1) Construction of recombinant plasmid pYX204

[0032] The phiC31attB sequence with only 51 bp was designed on the relevant primers, using the genome of Saccharopolyspora spinosa J1-019 as a template, the upstream primer 5'-GTGCCAAGCTTGCCTCGCTGAGCCCGTAGGAGTTGATCAC-3', the downstream primer 5'-GGTGGAGTACGCGCCCGGGGAGCCCAAGGGCACGCCCTGGCACCCGCACCGGCCGCCGCGGGCAACGACGCGG'PCRCAG Left homology arm sequence, upstream primer 5'-CGGTGCGGGTGCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCGTACTCCACCCGTCGATTCCTCGGGTAGGGCGCAG-3', downstream primer 5'-CGCGCGCGGCCGCTGGTGACCGGCCACGCGCTGGTC-3' to amplify the right homology arm sequence, recover the left and right homology arm gels and use OE-PCR method Ligated, the ligated fragments were digested with HindIII / NotI double enzymes, recovered and connected to the vector pOJ260 plasmid that had been digested with HindIII / NotI double enzymes, and the sequencing results showed that the c...

Embodiment 2

[0047] Example 2 Construction of overexpressing spnJ and spnP strains in 019-A strains

[0048] (1) Construction of plasmid pIB139-spnJ, pIB139-spnP

[0049] The inventors used the attB-attP site for integration, and selected the promoter ermEp to overexpress spnJ and spnP respectively. Using the extracted genomic DNA of Saccharopolyspora spinosa J1-019 as a PCR template, use the cloned fragment spnJ primers (upstream primer: 5'-ACGCCATATGATGATCTCGGCTGCGGGCGAACAAAG-3', downstream primer: 5'-GCGCGCGGCCGCTCATGGCTGACCGGGTGAAAGCCGTG-3') to amplify the size of The 1642bp target band spnJ was cloned with spnJ primers (upstream primer: 5'-ACGCCATATGGTGATTCTTGGCATGCTTCCCG-3', downstream primer: 5'-GCGCGCGGCCGCTCACGGATGGCCATCAGACTGC-3') to amplify the 1368bp target spnP, and the target strip The band and the pIB139 plasmid were digested with NdeI / NotI at the same time and then ligated with T4 ligase. After one of the plasmids identified by enzyme digestion was correctly sequenced, the...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides saccharopolyspora spinosa capable of highly yielding spinosad and a method for increasing the spinosad yield of the strain. The saccharopolyspora spinosa capable of highly yielding the spinosad includes a J1-019-A strain and a spinosad producing strain saccharopolyspora spinosa capable of overexpressing spnJ or spnP; according to the J1-019-A strain, a polyketide synthase gene cluster which is not related to spinosad synthesis is knocked out from a genome of an original spinosad producing strain saccharopolyspora spinosa, and an attB site which can be conveniently transformed subsequently is introduced; and the spinosad producing strain saccharopolyspora spinosa capable of overexpressing spnJ or spnP performs overexpression on the spnJ or spnP in the original spinosad producing strain saccharopolyspora spinosa. The spinosad producing strain provided by the invention can realize fermentation production of spinosad through amplified fermentation of a fermentation tank, and can achieve the potential of industrial production.

Description

technical field [0001] The invention belongs to the field of biotechnology, in particular to Saccharopolyspora spinosa with high spinosad production and a method for increasing the spinosad yield of the strain. Background technique [0002] Spinosad is a macrolide biopesticide produced by the actinomycete Saccharopolyspora spinosa through aerobic fermentation. Because spinosad is fast, efficient, low residue, Non-toxic to mammals and birds, the insecticide has been approved for registration and use in many countries, and has won the "Presidential Green Chemicals Challenge Award" in the United States. [0003] However, at present, many countries do not have the ability to produce spinosad by fermentation. The main reason is that the fermentation period of this strain is long and the fermentation yield is low, so it is difficult to implement industrialization. At present, it is a common solution to use biotechnology to transform fermentation strains to increase production and...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12P19/62C12R1/01
CPCC12N9/0004C12N9/1029C12N9/1048C12P19/62
Inventor刘天罡刘然
OwnerWUHAN UNIV