Application of agronomic characters of OsbZIP62-VP64-fused-expressed improved rice
A technique for agronomic traits and rice, applied in the field of genetic engineering, can solve problems such as unsatisfactory expression effects, and achieve the effect of increasing ear length and plant height
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0033]Example 1 Cloning of rice OsbZIP62 gene
[0034]Using the plasmid OsDTH1 constructed and stored in our laboratory as a template, the above downstream primers OsbZIP62F (5'ACAGCCCTGGAACATTGGCC 3'SEQ ID NO.3) and OsbZIP62R (5'TAGTTAAGAAAAGAGTTCGTCG 3'SEQID NO.4) were used to amplify the OsbZIP62 target fragment and condense The gel was recovered, connected to the pEASY-Blunt vector, and sequenced after identification. The sequencing results were confirmed by BLAST comparison. The results showed that the CDS sequence of rice OsbZIP62 in the present invention was 825 bp.
Embodiment 2
[0035]Example 2 Transformation of rice fusion gene OsbZIP62V overexpression vector into rice
[0036]1. Using GATEWAY recombinant cloning technology to construct an overexpression vector containing OsbZIP62 gene, the structure diagram is as followsfigure 1 Shown:
[0037]Using the pEasy-blunt vector containing the OsbZIP62 gene obtained in Example 1 as a template, the front primer F: 5'-AAAAAGCAGGCTATGGGAGTCCACGCA-3'SEQ ID NO. 5 was used, and the rear primer R: 5'-AGAAAGCTGGGTTTAGAAAGAGGC-3SEQ ID NO. 6'Perform the first round of PCR amplification. Then use the universal primer attB1adapter:5'-GGGGACAAGTTTGTACAAAAAAGCAGGCT-3'SEQ ID NO.7, attB2 adapter:5'-GGGGACCACTTTGTACAAGAAAGCTGGGT-3'SEQ ID NO.8 for the second round of PCR amplification. After the amplified product is recovered and purified, Through the BP reaction, the amplified product fragments were cloned into the entry vector pDONR, and positive clones were screened. Through the LR reaction, the target gene was recombined and cloned...
Embodiment 3
[0090]Example 3. Identification of agronomic traits of OsbZIP62V overexpression transgenic rice.
[0091]Disinfect the seeds of OsbZIP62V overexpression transgenic families (75% alcohol treatment for 1 min, 1.5% NaClO treatment for 20 min, sterile water washing 4-5 times), and germinate on 1 / 2MS medium containing 50mg / L hygromycin , The wild-type control was sown one day later on 1 / 2MS medium without hygromycin. After 2-3 days of germination, select seedlings with good germination and consistent growth to transplant into the field, and observe the phenotype when they grow at the booting stage. The experimental results showed that the over-expressing OsbZIP62V transgenic plants (OE11, OE12) had higher plant height, more branched japonica, and longer ear length than the wild-type control (WT).Figure 3-Figure 5)Wait. This result indicated that overexpression of OsbZIP62V gene improved rice agronomic traits.
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com