Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of agronomic characters of OsbZIP62-VP64-fused-expressed improved rice

A technique for agronomic traits and rice, applied in the field of genetic engineering, can solve problems such as unsatisfactory expression effects, and achieve the effect of increasing ear length and plant height

Active Publication Date: 2020-12-29
SUZHOU CHIEN SHIUNG INST OF TECH
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are still many genes whose expression effects are not satisfactory, so further research is needed on their related mechanisms

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of agronomic characters of OsbZIP62-VP64-fused-expressed improved rice
  • Application of agronomic characters of OsbZIP62-VP64-fused-expressed improved rice
  • Application of agronomic characters of OsbZIP62-VP64-fused-expressed improved rice

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033]Example 1 Cloning of rice OsbZIP62 gene

[0034]Using the plasmid OsDTH1 constructed and stored in our laboratory as a template, the above downstream primers OsbZIP62F (5'ACAGCCCTGGAACATTGGCC 3'SEQ ID NO.3) and OsbZIP62R (5'TAGTTAAGAAAAGAGTTCGTCG 3'SEQID NO.4) were used to amplify the OsbZIP62 target fragment and condense The gel was recovered, connected to the pEASY-Blunt vector, and sequenced after identification. The sequencing results were confirmed by BLAST comparison. The results showed that the CDS sequence of rice OsbZIP62 in the present invention was 825 bp.

Embodiment 2

[0035]Example 2 Transformation of rice fusion gene OsbZIP62V overexpression vector into rice

[0036]1. Using GATEWAY recombinant cloning technology to construct an overexpression vector containing OsbZIP62 gene, the structure diagram is as followsfigure 1 Shown:

[0037]Using the pEasy-blunt vector containing the OsbZIP62 gene obtained in Example 1 as a template, the front primer F: 5'-AAAAAGCAGGCTATGGGAGTCCACGCA-3'SEQ ID NO. 5 was used, and the rear primer R: 5'-AGAAAGCTGGGTTTAGAAAGAGGC-3SEQ ID NO. 6'Perform the first round of PCR amplification. Then use the universal primer attB1adapter:5'-GGGGACAAGTTTGTACAAAAAAGCAGGCT-3'SEQ ID NO.7, attB2 adapter:5'-GGGGACCACTTTGTACAAGAAAGCTGGGT-3'SEQ ID NO.8 for the second round of PCR amplification. After the amplified product is recovered and purified, Through the BP reaction, the amplified product fragments were cloned into the entry vector pDONR, and positive clones were screened. Through the LR reaction, the target gene was recombined and cloned...

Embodiment 3

[0090]Example 3. Identification of agronomic traits of OsbZIP62V overexpression transgenic rice.

[0091]Disinfect the seeds of OsbZIP62V overexpression transgenic families (75% alcohol treatment for 1 min, 1.5% NaClO treatment for 20 min, sterile water washing 4-5 times), and germinate on 1 / 2MS medium containing 50mg / L hygromycin , The wild-type control was sown one day later on 1 / 2MS medium without hygromycin. After 2-3 days of germination, select seedlings with good germination and consistent growth to transplant into the field, and observe the phenotype when they grow at the booting stage. The experimental results showed that the over-expressing OsbZIP62V transgenic plants (OE11, OE12) had higher plant height, more branched japonica, and longer ear length than the wild-type control (WT).Figure 3-Figure 5)Wait. This result indicated that overexpression of OsbZIP62V gene improved rice agronomic traits.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of agronomic characters of OsbZIP62-VP64-fused-expressed improved rice. According to the application, a transcriptional activation domain variant VP64 with rice gene transcription enhancing activity derived from a herpes virus and a gene OsbZIP62 in rice are subjected to fused recombination (OsbZIP62-VP64, OsbZIP62V); and by overexpression of the OsbZIP62V, theplant height and ear length of the rice can be improved, and the agronomic characters such as number of filled grain per panicle and primary / secondary branch number are improved. The rice gene OsbZIP62V disclosed by the invention has obvious influence on the agronomic characters of the rice, can be applied to molecular breeding of the rice and plays an important role in enriching germ plasm resources of the rice, creating new germ plasm and even shortening a breeding process.

Description

Technical field[0001]The invention relates to a gene related to important agronomic traits of rice, in particular to an application of OsbZIP62-VP64 fusion expression to improve agronomic traits of rice, belonging to the field of genetic engineering.Background technique[0002]Rice is an important food crop, providing security for more than 50% of the world’s population. In recent years, with the intensification of human activities, various climatic disasters have become more frequent, which have severely affected the physiological metabolism of rice, which in turn affected the physical and chemical properties of rice, such as plant height, ear length, and yield, and severely restricted crops. The long-term goal of breeding high yield and stable yield. Therefore, in-depth study of the physiological and molecular mechanisms of rice plant height and other agronomic traits is an important scientific requirement for cultivating new rice varieties with high and stable yields and ensuring f...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/29C12N15/82C07K14/415A01H5/00A01H6/46
CPCC07K14/415C12N15/8261C07K2319/71Y02A40/146
Inventor 杨诗勤徐凯罗利军封功能张楷歆王维
Owner SUZHOU CHIEN SHIUNG INST OF TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com