Nested PCR primer group, kit and detection method for specifically detecting sisal hemp purple leaf curl phytoplasma
A technique for planting plasmoids and primer sets, applied in biochemical equipment and methods, recombinant DNA technology, and microbial assay/inspection, etc., to achieve the effects of strong specificity, overcoming cumbersome steps, and shortening identification time
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] Embodiment 1, detection of sisal purple leafroll disease Phytoplasma nested PCR primer set acquisition
[0038] 1. Nested PCR amplification with universal primers and product cloning
[0039] The phytoplasma universal primer R16mF2 / R16mR1 (R16mF2: CATGCAAGTCGAACGGA / R16mR1: CTTAACCCCAATCATCGAC) was used to amplify the DNA of sisal purple leafroll disease-like plants by PCR.
[0040] Wherein, the reaction system of the first round of PCR amplification is as follows:
[0041]
[0042]
[0043] The reaction conditions for the first round of PCR amplification were: 94°C for 3 minutes; 35 cycles of 94°C for 30 seconds, 52°C for 30 seconds, and 72°C for 1 minute; 72°C for 10 minutes; and storage at 4°C.
[0044] After the first round of amplification was completed, the product was diluted 10 times, and the R16F2n / R16R2 primer (R16F2n: GAAACGACTGCTAAGACTGG / R16R2: TGACGGGCGGTGTGTACAAACCCCG) was used for nested amplification;
[0045] Among them, the reaction system of ne...
Embodiment 2
[0060] Embodiment 2, detect the specificity of sisal purple leafroll disease phytoplasma primer
[0061] The DNA of the diseased plants of sisal purple leafroll disease, as well as the common host pathogen Phytophthora nicotianae, Aspergilus niger, and the non-host pathogen Paramyrothecium roridum were selected. , Pestalotiopsistrachicarpicola, Fusarium solani, Coletotrichumgloeosporioides, Coletotrichum falcatum, Ustilagoscitaminea, Rice blast Genomic DNA of Magnaporthe oryzae, Xanthomonasoryzae pv. Oryzicola, and Bacilus subtilis were used as templates.
[0062] The plant DNA extraction of sisal purple leafroll disease was extracted by the plant DNA extraction kit of QIAGEN Company of Germany; Aspergilus niger, Paramyrothecium roridum, Pestalotiopsis trachicarpicola, Fusarium solani, Coletotrichum gloeosporioides ), Coletotrichum falcatum, Ustilago scitaminea, and Magnaporthe oryzae strain mycelia. The bacterial DNA extraction kit (Bacterial DNA kit, Omega bio-tek) extracti...
Embodiment 3
[0073] Embodiment 3: detect the sensitivity of sisal purple leaf curl disease phase primor primer
[0074] The method of constructing and extracting the 16S rDNA recombinant plasmid of Phytoplasma sisal purple leafroller is as follows:
[0075] Use the pEASY-T1 Cloning Kit to clone the PCR products (nucleotides shown in sequence 5 in the sequence listing) of the universal primers (R16mF2 / R16mR1 and R16F2n / R16R2), and the specific operations are as follows:
[0076] (1) Add 4 μL of PCR product and 1 μL of T1 carrier to mix, flick to mix well, centrifuge briefly, connect at 25°C for 15 min, and place it on ice after completion.
[0077] (2) When the Trans-T1 competent cells were similar to non-transformation, take 50 μL of competent cells and the ligation product and gently mix them, and ice-bath for 30 minutes.
[0078] (3) Remove the centrifuge tube from the ice, heat-shock in a water bath at 42°C for 60 seconds, then quickly insert it on ice for 2 minutes, add 250 μL of LB l...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap