Micro nucleic acid combined amplification testing method and kit

A technology of tiny nucleic acid and detection method, applied in the field of biochemistry, can solve the problems of low throughput, poor repeatability, complicated operation, etc., and achieve the effect of reducing complexity, enhancing specificity and stability, and enhancing sensitivity and repeatability

Pending Publication Date: 2021-03-16
杭州复杏生物科技有限公司
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] The purpose of the present invention is to specifically solve the problems of complex operation, poor repeatability, and low throughput of the above-mentioned fluorescent quantitative PCR method for miRNA detection, and to provide a method with simple operation, good repeatability, and high throughput that can be used in a system. Amplification detection method and kit for simultaneous detection of multiple miRNA combinations

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Micro nucleic acid combined amplification testing method and kit
  • Micro nucleic acid combined amplification testing method and kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Example 1: Using the method and kit to detect oligonucleotide probes mixed in Escherichia coli samples The composition of the kit for this method is as described in the text of the manual. We synthesized a template probe TSNOT that fully binds to four human miRNAs: miR-191, miR-93, miR-16, and miR-3662. The sequence is: CAGCTGCTTTTGGGATTCCGTTGCGCCAATATTTACGTGCTGCTACATCAGTCACTACTCATCATTTTCGTTTCACGACAAGCACGTCCATC, where the complementary sequences of miR-191 and miR-93 The complementary sequences of miR-16 and miR-3662 are located at the 5' and 3' ends of TSNOT respectively, and the complementary sequences of miR-16 and miR-3662 are connected in the middle of TSNOT, and the four sequences are connected continuously without any additional gap. As a format validation for co-detection of oligonucleotide probes spiked into E. coli samples. The oligonucleotide probe sequences were identical to the above four miRNAs: OLI-191, OLI-93, OLI-16, OLI-3662, and the sequences were: CA...

Embodiment 2

[0025] Example 2: Using this method and kit to detect 4 miRNAs in human lung cancer A549 cells

[0026] The composition of the method kit is as described in the text of the specification. The sequences of template probe TSNOT, primers PMF191 and PMR93 are as described in Example 1. We further use template probe TSNOT, primer PMF191, primer PMR93 system, with 20μl 10 5 / μl E. coli samples for negative samples, to 20μl 10 4 The human lung cancer A549 cell sample / μl is a positive sample, and the joint detection of four human miRNAs, miR-191, miR-93, miR-16, and miR-3662, is performed. The operation steps were the same as those described in Example 1, and the detection results: negative samples had no amplification, and positive samples had a Ct value of 26.77, indicating that the system can be used for joint detection of the four target miRNAs.

Embodiment 3

[0027] Example 3: Using this method and kit to detect 4 miRNAs in the culture medium of human lung cancer A549 cells

[0028] Cancer cells can actively secrete miRNAs to the surrounding environment through exosomes and microvesicles. These extracellular miRNAs can stably exist in body fluids or culture fluids for a long time due to the protection of the coating membrane. We cultured A549 cells continuously for 3 days, so that the growth density was close to 100%, and then collected 10 μl of culture medium, and used this method and kit to detect four human miRNAs, miR-191, miR-93, miR-16, and miR-3662. joint detection. The composition of the method kit is as described in the text of the specification. Template probe TSNOT, primers PMF191, PMR93 sequences, and operation steps are as described in Example 1. We further use template probe TSNOT, primer PMF191, primer PMR93 system, with 20μl 10 5 / μl of E. coli samples for negative samples, to 20μl10 4 The human lung cancer A54...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a micro nucleic acid joint testing method and kit. Multiple target micro nucleic acids are captured by hybridization of single-stranded template probes; excessive single-stranded template probes are removed by enzyme digestion of mung bean nuclease; a template probe forming double strands with the target micro nucleic acids is obtained by purification; then PCR amplificationtesting is carried out; and a positive amplification result indicates the presence of the target micro nucleic acid. According to the method and the kit, the PCR pretreatment steps of micro nucleic acid testing are reduced to three steps; the flux is increased to 4 times of a traditional PCR method, and the interference of genome DNA, a primary precursor, a secondary precursor and a double-stranded precursor is avoided, thus being conducive to improving and promoting popularization and application of micro nucleic acid testing.

Description

[0001] 1 technical field [0002] The invention belongs to the technical field of biochemistry, and in particular relates to a micro nucleic acid combined amplification detection method (miRNACombined Amplification Protocol, MCAP), a kit for micro nucleic acid detection using the method, and the method and kit for in vitro diagnosis and applications in identification. [0003] 2 background technology [0004] Micronucleic acid miRNA (microRNA, micro ribonucleic acid) is a kind of highly conserved single-stranded non-coding small molecule RNA in evolution, about 22 nucleotides (nt), widely present in eukaryotes including human and human-derived In tissues, blood, and body fluids, the primary precursor pri-miRNA produced by gene transcription is cut to obtain the secondary precursor pre-miRNA, which is cut again to obtain a double-stranded precursor (miRNA duplex), and finally obtained by unzipping. miRNA has a variety of important gene regulation functions in vivo, and its abno...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6886C12Q1/6851
CPCC12Q1/6851C12Q1/6886C12Q2600/158C12Q2600/178C12Q2531/113C12Q2525/207C12Q2521/30C12Q2565/519
Inventor陈燃徐逸丽杨颖浩
Owner杭州复杏生物科技有限公司