Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Freeze-drying protective agent of SNP detection reagent, and application

A technology of freeze-drying protective agent and detection reagent, which is applied in the biological field, can solve the problems of activity decline and loss, and achieve the effects of simple operation, reduced transportation cost, and avoiding repeated freezing and thawing

Pending Publication Date: 2021-04-09
HANGZHOU KMB BIOTECH
View PDF4 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the DNA polymerase in the SNP detection reagent will decrease or even lose its activity due to the low temperature effect, freezing effect, dehydration effect, etc. during the vacuum freeze-drying process.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Freeze-drying protective agent of SNP detection reagent, and application
  • Freeze-drying protective agent of SNP detection reagent, and application
  • Freeze-drying protective agent of SNP detection reagent, and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] 1. Prepare the CYP3A5 genotyping detection reagent, the composition of which is shown in Table 2;

[0030] Table 2

[0031]

[0032]

[0033] 2. The 9 groups of protective agents (A-I) in Table 1 were prepared into a premix with the CYP3A5 genotyping detection reagent, and the CYP3A5 genotyping detection reagent without the protective agent was used as a control;

[0034] 3. The CYP3A5 upstream primer sequence is CGTATGTACCACCCAGCTTA, the CYP3A5 downstream primer sequence is GGTGTGACACACAGCAAGAG, the CYP3A5 wild-type probe is TCTTTCAGTATCTCTTC, and the CYP3A5 mutant probe sequence is TCTTTCAATATCTCTT;

[0035] 4. Fully mix and centrifuge the above-mentioned frozen premix;

[0036] 5. The above-mentioned freeze-preparation mixture is divided into PCR tubes with a volume of 19 μL, and placed in a freeze dryer (model: LGJ-15E);

[0037] 6. Set the freeze-drying program: the partition temperature drops to -50°C, pre-freeze for 4 hours; the first drying stage, the pa...

Embodiment 2

[0054] 1. Select the freeze-dried CYP3A5 typing detection reagent prepared by A protective agent, B protective agent, and C protective agent to conduct a thermal stability experiment, and conduct a preliminary evaluation of the stability of the reagent. At the same time, set up 2 groups of control groups, one of which is the control group One group was liquid CYP3A5 genotyping detection reagent (without protective agent), and the other control group was freeze-dried CYP3A5 genotyping detection reagent (without protective agent), which were placed in a biochemical incubator at 37°C for 7 days ;

[0055] 2. Conduct appearance inspection after acceleration (see image 3 and Figure 4 ), the test sample selection wild type sample (G / G), heterozygous sample (G / A), mutant sample (A / A), the amplification procedure is the same as Table 4;

[0056] 3. After the amplification, according to the amplification curve, select the appropriate fluorescence threshold (generally, the threshold...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a freeze-drying protective agent of an SNP detection reagent, and a protection method. The freeze-drying protective agent comprises trehalose, glucan and gelatin. The protective agent disclosed by the invention realizes a purpose of constant-temperature transportation and constant-temperature preservation of the SNP detection reagent, and transportation cost is dramatically lowered. The freeze-drying protective agent is simple to operate, and pollution brought by repeated freeze thawing of the reagent and repeated utilization of the SNP detection reagent can be avoided.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a freeze-drying protective agent of a SNP detection reagent and its application. Background technique [0002] SNP (Single Nucleotide Polymorphisms) stands for single nucleotide polymorphism, which refers to the variation of a single nucleotide in the genome. SNPs are the most common type of heritable variation in humans. Accounts for more than 90% of all known polymorphisms. SNPs exist widely in the human genome, with an average of 1 in every 500-1000 base pairs, and it is estimated that the total number can reach 3 million or more. As a third-generation genetic marker, many phenotypic differences in the human body, susceptibility to drugs or diseases, etc. may be related to SNP. Therefore, the detection of SNP has important biological and medical significance. [0003] At present, most SNP detection tests are liquid, and its components DNA polymerase, dNTP, primers, probes, etc...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6806
CPCC12Q1/6806
Inventor 丁佳女郑宜文余霞陈亮
Owner HANGZHOU KMB BIOTECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com