Prokaryotic expression method and application of EqHV NS3 protein

A protein and expression bacteria technology, applied in the biological field, can solve the problems of lack of detection of EqHV antibodies, etc., achieve good stability, promote lymphocyte stimulation, good sensitivity and specificity

Pending Publication Date: 2021-04-13
ZHAOQING INST OF BIOTECHNOLOGY CO LTD
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, the existence of EqHV has been detected in more and more countries, but there has been a lack of methods for detecting EqHV antibodies in horses in China. At present, the only methods for detecting EqHV antibodies in horse serum are HCV or HCV-like proteins (LIPS and ELISA)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Prokaryotic expression method and application of EqHV NS3 protein
  • Prokaryotic expression method and application of EqHV NS3 protein
  • Prokaryotic expression method and application of EqHV NS3 protein

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0069] Example 1: Construction of recombinant expression vector pMAL-c5x-NS3

[0070] (1) Primer design

[0071] According to the NS3 gene (SEQ ID NO: 3) of EqHV strain, design PCR primer, NS3 gene PCR primer name is SacI 1893F and Bam I 1893R, and cDNA is the reverse transcription product of GD18 strain (the Guangdong strain of EqHV), The primer sequence contains Sac I and Bam I restriction sites, protective bases and bases to prevent frameshift (as shown in the underline), and the downstream primers are inserted with 3 6*His and terminators. The primers were provided by Tianyi Synthesized by Huiyuan Biological Co., Ltd., the sequence is as follows:

[0072] Sac I 1893F:

[0073] 5' ATCGAGCTC GATGTCACCTATTACAGCCACTGTCACT 3' (SEQ ID NO: 1)

[0074] Bam I 1893R:

[0075] 5' CGCGGATCC CTATCATTAATGGTGATGGTGATGATGATGGTGATGGTGATGATGATGGTGATGGTGATGATGCGTTTGGGTGTCAATCTCGGCCTCCAT 3' (SEQ ID NO: 2)

[0076] (2) PCR amplification of NS3 gene

[0077] Use the primers designed ...

Embodiment 2

[0119] Example 2: Expression and purification of recombinant NS3 protein

[0120] 1. Expression of recombinant NS3 protein

[0121] (1) Transform the recombinant expression vector pMAL-c5x-NS3 into the expression strain competent cell Rosetta (DE3), and the specific transformation method is the same as the step of transforming the above-mentioned ligation product into the E. coli DH5α competent cell;

[0122] (2) Use a sterilized 10 μL pipette tip to pick a single colony that grows well on the ampicillin plate, place it in 1 mL of ampicillin-resistant LB broth, place it in a shaker at 37°C, and shake at 180 rpm for 12 to 15 hours;

[0123] (3) Put the shaken bacterial solution into the ampicillin LB medium at a ratio of 1:100, and culture it in a shaker at 200 rpm at 37°C until the bacterial cell OD 600nm When the value is about 0.5, add the inducer IPTG with a final concentration of 1 mM, shake and culture in a shaker at 25°C for 5 hours, and then set aside;

[0124] (4) Ce...

Embodiment 3

[0140] Example 3: Determination of the optimal induction conditions for recombinant NS3 protein expression

[0141] (1) Determination of the optimal induction temperature

[0142] In the step (3) of the expression procedure of the recombinant NS3 protein of embodiment 2, when the bacterium OD 600nm When the value reaches about 0.6, take three bacterial solutions, add the same amount of IPTG to the bacterial solutions, induce expression at 25°C, 30°C and 37°C respectively, and culture at 180rpm for the same time. Centrifuge at 8000rpm for 5min at room temperature, discard the supernatant and retain the cells obtained by centrifugation, resuspend the cells with 0.1 times the original volume of PBS buffer, take the resuspended cells as loading samples for SDS-PAGE electrophoresis, The results of different induction temperatures for recombinant NS3 protein expression are shown in the attached Figure 6 As shown in the figure, M is Marker, 1 is the induction temperature of 25°C, ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of biology, and particularly relates to a prokaryotic expression method and application of EqHV NS3 protein. Prokaryotic expression is carried out on the EqHV NS3 protein, a polyclonal antibody of the EqHV NS3 protein is prepared at the same time, and technical reserves are provided for a detection method of EqHV in horse groups.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a prokaryotic expression method and application of EqHV NS3 protein. Background technique [0002] Equine hepatitis C virus (Equine Hepacivirus, EqHV) belongs to the Hepacivirus genus, and is a recently discovered equine hepatitis C infection virus. EqHV was first identified in horse herds in the United States in 2012. EqHV infection presents typical hepatic phagocytosis and has a potential pathogenic risk to equine animals. [0003] At present, the existence of EqHV has been detected in more and more countries, but there has been a lack of methods for detecting EqHV antibodies in horses in China. At present, the only methods for detecting EqHV antibodies in horse serum are HCV or HCV-like proteins (LIPS and ELISA) . [0004] NS3 protein is the most conserved protein in flaviviruses. In the research of detection of new equine flaviviruses, NS3 gene is mostly used as th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/11C12N15/70C12N15/66C12N1/21C07K19/00C07K1/22C07K16/10
CPCC12N15/70C12N15/66C07K14/005C07K16/109C07K2319/24C07K2319/21C12N2770/24222
Inventor李守军吴李嫣卢刚欧嘉俊邵冉
OwnerZHAOQING INST OF BIOTECHNOLOGY CO LTD