Unlock instant, AI-driven research and patent intelligence for your innovation.

HRM genotyping method and primers for detecting RHD1227A allele of erythrocyte Rh blood type system

A genotyping method and allele technology, applied in recombinant DNA technology, biochemical equipment and methods, DNA/RNA fragments, etc., can solve the problems that are not suitable for clinical large-scale routine testing, the operation process is time-consuming and laborious, and the operation skills are required. Advanced problems, to achieve the effect of extensive scientific research application value, low cost, and avoid cross-contamination

Pending Publication Date: 2021-04-16
广州血液中心
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The absorption-diffusion test has the problems of consuming too much antibody, time-consuming and labor-intensive operation, and high requirements for operating skills, so it is not suitable for large-scale routine clinical testing.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • HRM genotyping method and primers for detecting RHD1227A allele of erythrocyte Rh blood type system
  • HRM genotyping method and primers for detecting RHD1227A allele of erythrocyte Rh blood type system

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0027] Refer to the attached Figure 1-2 The primers for detecting the RHD*1227A allele HRM genotyping of the erythrocyte Rh blood group system in this embodiment include PCR amplification primers, and the PCR amplification primers include HRM upstream primers and HRM downstream primers. The primer sequences are as follows:

[0028] HRM upstream primer: ATATGGAAAGCACCTCATGA;

[0029] HRM downstream primer: AAACAGCAAGTCAACATATATACT.

[0030]Further, according to the RHD*1227A allele (sequence number AF390110) recorded in the GenBank of the National Center for Bioinformatics of the United States, the RHD*1227A allele was designed to amplify the 1227G>A mutation (rs549616139 ), finally determine a pair of specific oligonucleotide primer sequences (HRM upstream primer: ATATGGAAAGCACCTCATGA; HRM downstream primer: AAACAGCAAGTCAACATATACT), the length of the amplified product fragment is 139 bases; synthesis.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an HRM genotyping method and primers for detecting RHD1227A allele of an erythrocyte Rh blood type system, and particularly relates to the technical field of molecular biology. The sequences of the primers are as follows: an HRM upstream primer: ATATGGAAAGCACCTCATGA; and an HRM downstream primer: ATATGGAAAGCACCTCATGA. According to the method, the operation is simple, the detection speed is high, only about 2.5 hours are needed in the whole operation process, and the detection time is greatly shortened. The method has the advantages of low cost, high sensitivity, high specificity, good repeatability and the like, can be used for accurately and quickly analyzing, and is beneficial to popularization and application in clinical practice.

Description

technical field [0001] The invention relates to the field of molecular biology, in particular to a HRM genotyping method and primers for rapidly detecting the RHD*1227A allele of the erythrocyte Rh blood group system. Background technique [0002] The Rh blood group system (ISBT004) is one of the most complex human blood group systems. More than 50 blood group antigens have been discovered so far, among which the D antigen is the most immunogenic and can cause hemolytic transfusion reactions and severe hemolytic disease of the newborn clinically. has important clinical significance. The D antigen is encoded by the RHD gene. According to the expression of the D antigen on the red blood cell membrane, the D antigen blood type can be divided into D positive, D negative, D variant and D diffuse type (D-elute, DEL). [0003] The DEL type of the Rh blood group system is a RhD antigen phenotype discovered by the Japanese scholar Okobo in 1984 in the RhD-negative blood donors who w...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6858C12N15/11
Inventor 姬艳丽王贞温机智
Owner 广州血液中心