HRM genotyping method and primers for detecting RHD1227A allele of erythrocyte Rh blood type system
A genotyping method and allele technology, applied in recombinant DNA technology, biochemical equipment and methods, DNA/RNA fragments, etc., can solve the problems that are not suitable for clinical large-scale routine testing, the operation process is time-consuming and laborious, and the operation skills are required. Advanced problems, to achieve the effect of extensive scientific research application value, low cost, and avoid cross-contamination
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0027] Refer to the attached Figure 1-2 The primers for detecting the RHD*1227A allele HRM genotyping of the erythrocyte Rh blood group system in this embodiment include PCR amplification primers, and the PCR amplification primers include HRM upstream primers and HRM downstream primers. The primer sequences are as follows:
[0028] HRM upstream primer: ATATGGAAAGCACCTCATGA;
[0029] HRM downstream primer: AAACAGCAAGTCAACATATATACT.
[0030]Further, according to the RHD*1227A allele (sequence number AF390110) recorded in the GenBank of the National Center for Bioinformatics of the United States, the RHD*1227A allele was designed to amplify the 1227G>A mutation (rs549616139 ), finally determine a pair of specific oligonucleotide primer sequences (HRM upstream primer: ATATGGAAAGCACCTCATGA; HRM downstream primer: AAACAGCAAGTCAACATATACT), the length of the amplified product fragment is 139 bases; synthesis.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 

