Unlock instant, AI-driven research and patent intelligence for your innovation.

A method for the quantification of NSLTP allergens in Artemisia pollen

A technology of Artemisia plants and allergens, applied in the field of biotechnology detection, can solve the problems of low allergen content, great difference in allergen active ingredients, missed detection and desensitization treatment effect, etc., and achieve accurate quantitative results

Active Publication Date: 2022-05-17
ZHEJIANG UNIV
View PDF10 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The preparations currently used for clinical diagnosis and desensitization treatment are mainly pollen extracts, and the active ingredients of allergens contained in these extracts vary greatly due to different types and batches, and the content of some important allergens in the extracts It is very low, and there are often problems such as missed detection or insignificant desensitization treatment effect in diagnosis and treatment. Therefore, in order to improve the efficiency of clinical diagnosis and treatment, it is very important to quantify the main allergens in the extract

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method for the quantification of NSLTP allergens in Artemisia pollen
  • A method for the quantification of NSLTP allergens in Artemisia pollen
  • A method for the quantification of NSLTP allergens in Artemisia pollen

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Extract protein from Artemisia annua and Mugwort pollen. Protein extraction and purification method: Dissolve 2 g of pollen in 35 mL of PBS (pH 7), extract overnight on a shaker at 4°C, centrifuge at 10,000 g for 20 minutes, collect the supernatant, and filter with a 0.22 μm Millipore membrane to obtain pollen protein extract. The BCA method was used to determine the total protein concentration of the extracted species.

[0030] Immunize 5 mice with 100 μg of Artemisia annua and Artemisia annua pollen extracts, inject 50 μg protein extracts every 7-14 days, a total of 6 times, recombinant Art v 3 and Artemisia mugwort protein extracts were used together for ELISA and Western-blot to screen specific monoclonal antibodies, and the obtained monoclonal cell lines were used to prepare ascites, and after detection, the monoclonal antibodies produced were purified by Protein G chromatography, and a total of 4 kinds of specific monoclonal antibodies to Art v 3 allergens were ob...

Embodiment 2

[0035] Proteins were extracted from 6 kinds of common Artemisia annua (Artemisia annua, Artemisia mugwort, Artemisia capillary, Artemisia chinensis, Wild Artemisia, Artemisia grandis) and European Artemisia argyi pollen, and the extraction method was the same as in Example 1. Take 0.5 μg of 7 kinds of artemisia pollen extracts to coat the plate, then add 0.03 μg of 4 kinds of Art v 3 monoclonal antibodies, HRP-labeled goat anti-mouse IgG (1:5000 dilution) as the secondary antibody, TMB color development, record 450 / 620nm absorbance value, compare the affinity of each antibody with different artemisia pollen extracts, such as figure 2 As shown, the binding values ​​of A11-B2 and 7 kinds of Artemisia pollen extracts were all low, and the other 3 mAbs had higher affinity with 6 kinds of Artemisia spp. The affinity with A2-B8 is higher than that of 5-E10, and for Artemisia grandis, the affinity of A9-G10 is much higher than that of the other three mAbs.

Embodiment 3

[0037] The mRNAs of 6 kinds of common Artemisia pollen in my country were extracted and reverse-transcribed into cDNA. According to the existing Art v3 sequences in the IUIS database, specific primers for Art v 3 type allergens were designed (upstream: ATGGCAATGAAAATGATGAA; downstream: CTAGCATAAAGYAYTTCAC), capillary The primers of Artemisia grandis and Artemisia grandis need to be adjusted according to the transcriptome sequencing results. Artemisia captorifera primers: upstream ATGGCAATRAAAATGATGAAGG, downstream: TTCCATGTATTCCAGCATAAA; Artemisia grandis primers: upstream: ATGGCAATGAAAATGATGAAG, downstream: TCATTTCACCTTGTTGCAATC, so as to obtain Art v 3 of six Artemisia spp. Amino acid sequences of type allergens such as image 3 As shown, the Art v 3 type allergens in the 6 kinds of Artemisia pollen each had two different subtypes. Name each subtype according to the IUIS allergen naming rules, as shown in Table 2 and image 3 shown.

[0038] Table 2 GeneBank numbers of Art v...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for quantifying nsLTP allergens in the pollen of Artemisia plants, using double monoclonal antibody sandwich enzyme-linked immunosorbent assay for quantification, wherein the combined primary antibody is A2‑B8 monoclonal antibody, from Hangzhou Aileji Biotechnology Co., Ltd. company, Cat. No. MA‑A2B8; the detection secondary antibody is A9‑G10 monoclonal antibody, from Hangzhou Aileji Biotechnology Co., Ltd., Cat. No. MA‑A9G10. The method for quantifying the nsLTP allergen in the pollen of the genus Artemisia in the present invention has high sensitivity and specificity, and can quantify the Artv 3 type allergen in the pollen of the genus Artemisia.

Description

technical field [0001] The invention relates to the technical field of biotechnology detection, in particular to a method for quantifying nsLTP allergens in Artemisia plant pollen. Background technique [0002] Artemisia plant pollen is one of the main allergens causing allergic diseases in summer and autumn. According to statistics, 11.3% of patients with respiratory allergies in my country are allergic to Artemisia pollen, especially in the north (more than 50%). Artemisia plants are widely distributed in my country, and there are many kinds, including Artemisia annua, A.argyi, A.sieversiana, A.capillaris, and A. lavandulifolia) is the most common, and the pollen extract currently used for in vitro diagnosis and immunotherapy is mainly from Artemisia grandis. [0003] There are 7 kinds of Artemisia pollen allergens that have been identified, according to the allergens formulated by the Allergen Nomenclature Sub-committee (http: / / www.allergen.org) under the International Un...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): G01N33/68G01N33/577G01N33/543G01N33/58
CPCG01N33/6893G01N33/577G01N33/54393G01N33/581G01N2333/415G01N2800/24
Inventor 高中山赵岚高毕远付婉艺
Owner ZHEJIANG UNIV