A method for the quantification of NSLTP allergens in Artemisia pollen
A technology of Artemisia plants and allergens, applied in the field of biotechnology detection, can solve the problems of low allergen content, great difference in allergen active ingredients, missed detection and desensitization treatment effect, etc., and achieve accurate quantitative results
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] Extract protein from Artemisia annua and Mugwort pollen. Protein extraction and purification method: Dissolve 2 g of pollen in 35 mL of PBS (pH 7), extract overnight on a shaker at 4°C, centrifuge at 10,000 g for 20 minutes, collect the supernatant, and filter with a 0.22 μm Millipore membrane to obtain pollen protein extract. The BCA method was used to determine the total protein concentration of the extracted species.
[0030] Immunize 5 mice with 100 μg of Artemisia annua and Artemisia annua pollen extracts, inject 50 μg protein extracts every 7-14 days, a total of 6 times, recombinant Art v 3 and Artemisia mugwort protein extracts were used together for ELISA and Western-blot to screen specific monoclonal antibodies, and the obtained monoclonal cell lines were used to prepare ascites, and after detection, the monoclonal antibodies produced were purified by Protein G chromatography, and a total of 4 kinds of specific monoclonal antibodies to Art v 3 allergens were ob...
Embodiment 2
[0035] Proteins were extracted from 6 kinds of common Artemisia annua (Artemisia annua, Artemisia mugwort, Artemisia capillary, Artemisia chinensis, Wild Artemisia, Artemisia grandis) and European Artemisia argyi pollen, and the extraction method was the same as in Example 1. Take 0.5 μg of 7 kinds of artemisia pollen extracts to coat the plate, then add 0.03 μg of 4 kinds of Art v 3 monoclonal antibodies, HRP-labeled goat anti-mouse IgG (1:5000 dilution) as the secondary antibody, TMB color development, record 450 / 620nm absorbance value, compare the affinity of each antibody with different artemisia pollen extracts, such as figure 2 As shown, the binding values of A11-B2 and 7 kinds of Artemisia pollen extracts were all low, and the other 3 mAbs had higher affinity with 6 kinds of Artemisia spp. The affinity with A2-B8 is higher than that of 5-E10, and for Artemisia grandis, the affinity of A9-G10 is much higher than that of the other three mAbs.
Embodiment 3
[0037] The mRNAs of 6 kinds of common Artemisia pollen in my country were extracted and reverse-transcribed into cDNA. According to the existing Art v3 sequences in the IUIS database, specific primers for Art v 3 type allergens were designed (upstream: ATGGCAATGAAAATGATGAA; downstream: CTAGCATAAAGYAYTTCAC), capillary The primers of Artemisia grandis and Artemisia grandis need to be adjusted according to the transcriptome sequencing results. Artemisia captorifera primers: upstream ATGGCAATRAAAATGATGAAGG, downstream: TTCCATGTATTCCAGCATAAA; Artemisia grandis primers: upstream: ATGGCAATGAAAATGATGAAG, downstream: TCATTTCACCTTGTTGCAATC, so as to obtain Art v 3 of six Artemisia spp. Amino acid sequences of type allergens such as image 3 As shown, the Art v 3 type allergens in the 6 kinds of Artemisia pollen each had two different subtypes. Name each subtype according to the IUIS allergen naming rules, as shown in Table 2 and image 3 shown.
[0038] Table 2 GeneBank numbers of Art v...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


