Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Recombinant mutant adeno-associated virus capable of efficiently infecting primary microglial cells and related biological material of recombinant mutant adeno-associated virus

A technology of microglia and biomaterials, which can be applied to viruses, viral peptides, microorganisms, etc., and can solve problems such as limiting the application of AAV

Active Publication Date: 2021-05-18
INST OF ZOOLOGY CHINESE ACAD OF SCI
View PDF5 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

It has been confirmed that AAV-1, 2, 3, 4, 5, 7, 8, and 9 hardly infect any microglial cells in vitro and in vivo, and AAV-6 infects microglial cells in vitro with an efficiency of less than 10 %, which greatly limits the application of AAV in microglia

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant mutant adeno-associated virus capable of efficiently infecting primary microglial cells and related biological material of recombinant mutant adeno-associated virus
  • Recombinant mutant adeno-associated virus capable of efficiently infecting primary microglial cells and related biological material of recombinant mutant adeno-associated virus
  • Recombinant mutant adeno-associated virus capable of efficiently infecting primary microglial cells and related biological material of recombinant mutant adeno-associated virus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Example 1. Construction of recombinant adeno-associated virus and analysis of its infection in primary microglial cells

[0046] 1. Packaging of recombinant adeno-associated virus (AAV)

[0047] 1. Preparation of recombinant plasmids (see figure 1 Middle A-D):

[0048] 1.1. Preparation of recombinant capsid packaging plasmid pAAV-6X

[0049] Using pAAV-RC6 as the original template, the sequence to be inserted (the underlined sequence in R) was designed on the downstream primer R, and the foreign sequence was inserted into the capsid sequence of pAAV-RC6 by PCR. Upstream primer F (nucleotide sequence is 5'-ACAGCAGCTACGCGCACA-3') and downstream primer R (nucleotide sequence is 5'-AGGCTCCCATAACATGCACATCTCCGGTCGCAGGGTCTGT CAGACGCGTCGGACCAACCGG GCTGCTGCTCTGGAGATTGAC-3′) 1 μl each (working solution concentration 10 μM), after 15 cycles, 1 μl Dpn1 enzyme was added to the PCR product to digest the original template plasmid pAAV-RC6. Afterwards, the PCR amplified product wa...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a recombinant mutant adeno-associated virus capable of efficiently infecting primary microglial cells and a related biological material of the recombinant mutant adeno-associated virus. The recombinant adeno-associated virus is an adeno-associated virus for expressing AAV-6X type capsid protein, and the AAV-6X type capsid protein is protein with an amino acid sequence as shown in a sequence 4 in a sequence table. According to the recombinant mutant adeno-associated virus, wild AAV-6 type capsid protein is subjected to the following mutation to obtain the mutated AAV-6 type capsid protein: seven amino acid residues are inserted between the 588 site and the 589 site of the amino acid sequence of the AAV-6 type capsid protein. The efficiency of in-vitro microglial cell infection of the recombinant adeno-associated virus rAAV-6X (expressing the AAV-6X type capsid protein) is 8 times that of the recombinant adeno-associated virus rAAV-6 (expressing the wild type AAV-6 type capsid protein). The recombinant adeno-associated virus provided by the invention is an rAAV vector for efficiently transducing the microglial cells.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a recombinant mutant adeno-associated virus that efficiently infects primary microglial cells and related biological materials. Background technique [0002] Studies in recent years have shown that the degree of nerve damage seems to be related to the scale and activity of innate immune activity. In the central nervous system, microglia are the main immune cells and the first type of cells to respond to nerve injury, infection or pathological changes. In addition to the role of immune response, microglia play important functions such as support, nutrition, and protection in the physiological activities of neurons, and also participate in the shaping and repair of neuronal connectivity during development, and participate in neuronal synaptic plasticity processes of formation, neurogenesis, and learning. Accumulating evidence suggests that microglia-associated signaling pathways may ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N7/01C12N15/864C07K14/015C12N15/35C12R1/93
CPCC12N7/00C12N15/86C07K14/005C12N2750/14121C12N2750/14143C12N2750/14122C12N2750/14151C12N2800/107
Inventor 滕兆乾何炫程刘长梅杜洪震
Owner INST OF ZOOLOGY CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com