Recombinant mutant adeno-associated virus capable of efficiently infecting primary microglial cells and related biological material of recombinant mutant adeno-associated virus
A technology of microglia and biomaterials, which can be applied to viruses, viral peptides, microorganisms, etc., and can solve problems such as limiting the application of AAV
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0045] Example 1. Construction of recombinant adeno-associated virus and analysis of its infection in primary microglial cells
[0046] 1. Packaging of recombinant adeno-associated virus (AAV)
[0047] 1. Preparation of recombinant plasmids (see figure 1 Middle A-D):
[0048] 1.1. Preparation of recombinant capsid packaging plasmid pAAV-6X
[0049] Using pAAV-RC6 as the original template, the sequence to be inserted (the underlined sequence in R) was designed on the downstream primer R, and the foreign sequence was inserted into the capsid sequence of pAAV-RC6 by PCR. Upstream primer F (nucleotide sequence is 5'-ACAGCAGCTACGCGCACA-3') and downstream primer R (nucleotide sequence is 5'-AGGCTCCCATAACATGCACATCTCCGGTCGCAGGGTCTGT CAGACGCGTCGGACCAACCGG GCTGCTGCTCTGGAGATTGAC-3′) 1 μl each (working solution concentration 10 μM), after 15 cycles, 1 μl Dpn1 enzyme was added to the PCR product to digest the original template plasmid pAAV-RC6. Afterwards, the PCR amplified product wa...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap