[0029] Referring to the accompanying drawings, the present invention will be further described in conjunction with specific embodiments, so as to better understand the present invention. If no specific technique or condition is indicated in the examples, it shall be carried out according to the technique or condition described in the literature in this field or according to the product specification. The reagents or instruments used were not indicated by the manufacturer, and they were all commercially available conventional products.
[0030] 1 Experimental materials
[0031] (1) Bananas (M. acuminata L. AAA group cv Brazilian) were obtained from the banana plantation of the Institute of Tropical Biotechnology (20N, 110E, Chiang Mai, Hainan Province, China), and were transported to the laboratory immediately after harvest. Select a healthy fruit comb and divide it into individual fruit fingers. Select intact and undamaged fruit fingers and sterilize the surface with 0.1% sodium hypochlorite for 10 minutes, then dry them and store them in a 22° incubator with a relative humidity of 80%. spare. Select fruit fingers with similar maturity and straight fruit shape, and cut them into 2 to 4 mm thick slices for subsequent VIGS experiments.
[0032] (2) Acquisition of genes
[0033] 1. Acquisition of banana transcription factor MuMADS1 gene (Ma05_t18560.1 gene ID number)
[0034] Using banana cDNA as a template and using MuMADS1p1:ATGGGAAGGGGTAAGATTGA, MuMADS1p2:CGCCGCTGAATCCGCCTTGG as primers, a sequence with a base sequence of 705bp was obtained by PCR amplification, and the sequencing results showed that it was consistent with the genome sequence.
[0035] 2. Acquisition of banana transcription factor MaMADS55 gene (Ma09_t01340.1 gene ID number)
[0036] Using banana cDNA as a template and using MaMADS55p1:ATGGGGAGGGGGAGAGTGG, MaMADS55p2:AGCAAGCCATCCTGGCACG as primers, a sequence with a base sequence of 729bp was amplified by PCR method, and the sequencing results showed that it was consistent with the genome sequence.
[0037] 3. Acquisition of Banana MaGWD1 Gene Promoter
[0038] Using banana DNA as a template, using MaGWD1promoter p1:GGCTTGATCCGAATCCATTTG, MaGWD1promoter p2:GGAGGGAGAGAAAGAGAGCGA as primers, a sequence containing a base sequence of 1,944bp obtained by PCR amplification is shown in SEQ ID No.1.
[0039] 1. Yeast one-hybrid experiment
[0040] Yeast one-hybrid assays were performed using the Matchmaker yeast one-hybrid system. We cloned the MaGWD1 promoter with a length of 1,944bp, double-digested with EcoRI and SalI restriction sites, recovered from the agarose gel extraction kit (E.Z.N.A.TM GelExtraction Kit, OMEGA), and ligated with T4-DNA ligase at 16°C. It is linked upstream of the reporter gene AUR1-C, an antibiotic resistance gene from the yeast strain pAbAi that confers resistance to aureobasidin A (Xiao et al., 2013). The constructed vector plasmid (represented by pAbAi-MaGWD1 hereinafter) was linearized and transformed into Y1H Gold competent, and spread on SD/-Ura solid medium containing different concentrations of AbA antibiotics for screening AbA concentration.
[0041] The transcription factor MuMADS1 gene was seamlessly cloned and Nimble Mix enzyme connected at 37°C, and constructed in the prey vector pGADT7 (hereinafter referred to as pGADT7-MuMADS1), the transcription factor MaMADS55 gene was seamlessly cloned, Nimble Mix enzyme connected at 37°C, and constructed in The prey vector pGADT7 (hereinafter referred to as pGADT7-MaMADS55). Then pAbAi-MaGWD1 and pGADT7-MuMADS1 co-transformed Y1H yeast cells, pAbAi-MaGWD1 and pGADT7-MaMADS55 co-transformed Y1H yeast cells, and cultured on SD/-Leu medium containing aureobasidin A at 29°C for 3 days.
[0042] see results figure 1. By constructing the transcription factor MuMADS1 gene in the prey vector pGADT7 AD, MaMADS55 gene in the prey vector pGADT7 AD, MaGWD1 promoter in the bait vector pAbAi, and then pAbAi-MaGWD1 and pGADT7-MaMADS55 co-transformed Y1H yeast cells, pAbAi-MaGWD1 and pGADT7-MuMADS1 Co-transformed Y1H yeast cells, the results showed that when pAbAi-MaGWD1 was co-transformed with pGADT7-MuMADS1 and pGADT7-MaMADS55 respectively, the yeast cells grew well in the presence of aureobasidin A; Yeast cells did not grow when -AD plasmids were co-transformed ( figure 1 B). These results indicated that MuMADS1 and MaMADS55 could interact with the MaGWD1 promoter and directly target MaGWD1 gene.
[0043] 2. Dual luciferase reporter assay
[0044] In order to explore the binding activity of MuMADS1 and MaMADS55 to the MaGWD1 promoter, we double digested the MaGWD1 promoter with BamHI/SalI restriction sites, recovered the agarose gel recovery kit (E.Z.N.A.TM Gel Extraction Kit, OMEGA), and T4-DNA Ligase was ligated at 16°C and inserted into the pGreenII 0800-LUC dual reporter vector as a reporter (hereinafter referred to as pGreenII 0800-MaGWD1) (Hellens et al., 2005). Afterwards, the MuMADS1 gene was digested by NotΙ/BbaΙ restriction sites, recovered by an agarose gel extraction kit (E.Z.N.A.TM Gel Extraction Kit, OMEGA), ligated with T4-DNA ligase at 16°C, and inserted into the vector pGreenII 62-SK Construct the effector (represented by pGreenII62SK-MuMADS1 below), the MaMADS55 gene was double-digested by NotI/BbaI restriction site, recovered by agarose gel recovery kit (E.Z.N.A.TM Gel Extraction Kit, OMEGA), T4-DNA ligase After ligation at 16°C, the effector was constructed by inserting into the vector pGreenII 62-SK (hereinafter referred to as pGreenII 62SK-MaMADS55). The obtained effectors and reporters were co-infiltrated into tobacco leaves and cultured for 48 hours. The dual luciferase assay kit (Promega, USA) and Luminoskan Ascent microplate photometer (Thermo Fisher Scientific) were used to measure the expression of LUC and REN luciferase. active. The transcriptional activation ability of MuMADS1 and MaMADS55 on the MaGWD1 promoter was evaluated according to the ratio of LUC/REN. For each combination, we employed six biological replicates.
[0045] see results figure 2. The MuMADS1 gene and MaMADS55 gene were respectively constructed into the pGreenII 62SK effector vector, and the MaGWD1 promoter was constructed into the pGreenII 0800 reporter vector ( figure 2 A), then pGreenII 62SK-MuMADS1+pGreenII 0800-MaGWD1 (ratio 5:1), pGreenII 62SK-MaMADS55+pGreenII0800-MaGWD1 (ratio 5:1) and pGreenII 62SK-MuMADS1+pGreenII 62SK-MaMADS55+pGreenII 0800-MaGWD1 Tobacco was transformed (ratio 5:5:2), and pGreenII 62SK was used as a negative control. The results showed that the luciferase (LUC)/renilla luciferase (REN) ratio of pGreenII62SK-MuMADS1+pGreenII 0800-MaGWD1 was 3.47, which was 3.69 times that of CK- (0.95); pGreenII 62SK-MaMADS55+pGreenII 0800- The LUC/REN ratio of MaGWD1 was 3.61, which was 3.80 times that of CK-. ; The LUC/REN ratio of pGreenII 62SK-MuMADS1+pGreenII 62SK-MaMADS55+pGreenII0800-MaGWD1 is 7.28, which is 7.66 times that of CK- ( figure 2B). These results indicated that MuMADS1 and MaMADS55 could respectively bind to the MaGWD1 promoter to induce the overexpression of LUC, not only that MuMADS1 could also cooperate with MaMADS55 to regulate the MaGWD1 promoter to increase the expression of LUC, indicating that the expression of MuMADS1 and MaMADS55 could promote the up-regulated expression of MaGWD1 gene, and The synergistic expression of MuMADS1 and MaMADS55 has a better effect of promoting the up-regulated expression of MaGWD1 gene.
[0046] 3. GUS staining analysis
[0047] The MuMADS1 gene was seamlessly cloned, Nimble Mix enzyme connected at 37°C, and inserted into the pCAMBIA1304 vector to construct the effector (hereinafter referred to as pCAMBIA1304-MuMADS1), and the MaMADS55 gene was seamlessly cloned, NimbleMix enzyme connected at 37°C, and inserted into the pCAMBIA1304 vector to Construct the effector (represented by pCAMBIA1304-MaMADS55 below), replace the 35S promoter of pBI121 with the MaGWD1 promoter by the Agrobacterium-mediated method to construct the reporter (represented by pBI121-MaGWD1 below), and combine the above-mentioned effector and reporter Co-transformation of banana fruit slices. According to Jefferson's (1987) method, the banana fruit was cut into thin slices with approximately the same shape and thickness, and soaked in 0.5% sodium hypochlorite solution for 15 minutes for later use. Resuspend the Agrobacterium bacteria solution to OD600=0.6-0.8, add 150 μmol/L acetosyringone (AS), and incubate at room temperature in the dark for 2-3 hours, put an appropriate amount of banana slices into the incubated bacteria solution, and carry out Vacuum-assisted infection was carried out, and banana thin slices were evenly placed on 1/2MS solid medium for 3 days in the dark at 28°C, and each group was repeated three times. Thin slices of similar size were selected and placed in a centrifuge tube, and were infected with a GUS staining kit (Real-Times, China) to measure GUS activity.
[0048] see results figure 2. The MuMADS1 gene and MaMADS55 gene were respectively constructed into the plant expression vector pCAMBIA1304, and the MaGWD1 promoter was constructed to replace the 35S promoter into the pBI121 vector as a reporter vector ( figure 2 C), then pBI121-MaGWD1+pCAMBIA1304-MuMADS1 (ratio 1:4), pBI121-MaGWD1+pCAMBIA1304-MaMADS55 (ratio 1:4) and pBI121-MaGWD1+pCAMBIA1304-MuMADS1+pCAMBIA1304-MaMADS55 (ratio 1:2: 2) Co-transformed banana fruit slices, and the empty reporter vector was used as a control. The results showed that the GUS activity of the control group was 3.13pmol 4-MUG.min -1.μg -1 , the GUS activity of pBI121-MaGWD1+pCAMBIA1304-MuMADS1 co-infected banana fruit slice experiment group was 4.65pmol 4-MUG.min -1.μg -1 , the GUS activity of pBI121-MaGWD1+pCAMBIA1304-MaMADS55 co-infected banana fruit slice experiment group was 4.81pmol 4-MUG.min -1.μg -1 , the GUS activity of pBI121-MaGWD1+pCAMBIA1304-MuMADS1+pCAMBIA1304-MaMADS55 co-infected banana fruit slice experiment group was 8.27pmol 4-MUG.min -1.μg -1 , compared with the MaGWD1 promoter and pCAMBIA1304-MuMADS1 alone, and the MaGWD1 promoter and pCAMBIA1304-MaMADS55 alone, the GUS staining in the banana fruit slice experiment group co-infected with the MaGWD1 promoter and pCAMBIA1304-MuMADS1+ and pCAMBIA1304-MaMADS55 was the deepest and GUS activity was the highest ( figure 2 D and 2E). These results indicated that MuMADS1 and MaMADS55 could regulate the expression of MaGWD1; moreover, the interaction of MuMADS1 and MaMADS55 greatly enhanced the transcriptional regulation of MaGWD1. It shows that MuMADS1 and MaMADS55 can promote the up-regulated expression of MaGWD1 gene, and the synergistic expression of MuMADS1 and MaMADS55 can promote the up-regulated expression of MaGWD1 gene better.
[0049] 4. Virus-mediated gene silencing (VIGS)
[0050] Tobacco rattle virus vector (pTRV: pTRV1 and pTRV2) was donated by Mr. Shi Haitao from Hainan University. PCR was carried out using banana cDNA as a template, and the MuMADS1 gene was double-digested with KpnΙ/SmaΙ restriction sites, recovered with an agarose gel recovery kit (E.Z.N.A.TM Gel Extraction Kit, OMEGA), and ligated with T4-DNA ligase at 16°C. Insert the pTRV2 vector to construct the virus vector (represented by pTRV2-MuMADS1 hereinafter); the MaMADS55 gene is double-digested by Kpn1/Sma1 restriction site, recovered by agarose gel recovery kit (E.Z.N.A.TM Gel Extraction Kit, OMEGA), T4 - DNA ligase was ligated at 16°C and inserted into the pTRV2 vector to construct a viral vector (hereinafter referred to as pTRV2-MaMADS55).
[0051] Transform pTRV1, pTRV2, pTRV2-MuMADS1 and pTRV2-MaMADS55 into Agrobacterium strain GV3101, culture at 28°C for 2 days, pick a single clone for PCR verification, and obtain Agrobacterium GV3101 containing pTRV1 (pTRV1 bacteria) and Agrobacterium GV3101 containing vector pTRV2 (pTRV2 strain), Agrobacterium GV3101 containing vector pTRV2-MuMADS1 (pTRV2-MuMADS1 strain) and Agrobacterium GV3101 containing vector pTRV2-MaMADS55 (pTRV2-MaMADS55 strain). Positive clones were cultured to OD at 28°C in YEP liquid medium supplemented with Rif/Kan antibiotics 600 The value is 0.8, use infection buffer (10mmol/LmgCl2, 10mmol/L MES, 200μmol/L acetosyringone) to resuspend, then mix the resuspension of pTRV2 bacteria with the resuspension of pTRV1 at a ratio of 3:1 As CK, mix the resuspension of pTRV2-MuMADS1 with the resuspension of pTRV1 at a ratio of 3:1 (hereinafter referred to as pTRV1+pTRV2-MuMADS1), and mix the resuspension of pTRV2-MaMADS55 with the resuspension of pTRV1 The solution was mixed at a ratio of 3:1 (hereinafter referred to as pTRV1+pTRV2-MaMADS55), and the resuspension of pTRV2-MuMADS1 bacteria, the resuspension of pTRV2-MaMADS55 bacteria and the resuspension of pTRV1 were mixed at a ratio of 1.5:1.5:1 Proportional mixing (hereinafter represented by pTRV1+pTRV2-MuMADS1+pTRV2-MaMADS55), adjust OD 600 value to 0.8. Cut the banana fruit into thin slices with a thickness of approximately 2-4 mm, soak in 0.5% sodium hypochlorite solution for 15 minutes for later use, and completely immerse the banana fruit slices in the resuspension solution under 600 mmHg for vacuum infection for 15 minutes-30 minutes. After the vacuum was released, the fruit slices were placed in Murashige & Skoog (MS) medium and cultured at 23°C for 3 days. We sampled banana fruit slices in each treatment for I 2 -KI staining, gene expression and physiological index analysis.
[0052] (1) I 2 -KI staining
[0053] Soak the processed banana fruit slices in 0.5% I 2 -Stain in KI solution for 150s. The stained fruit sections were washed with deionized water and immediately blotted dry with filter paper. Images were collected using Nikon Eclipse ci (Nikon, Japan) and scanned using Pannoramic DESK (Panoramic, Hungary).
[0054] see results image 3 , I in pTRV1+pTRV2-MaMADS55 and pTRV1+pTRV2-MuMADS1 transformants compared to CK 2 -KI staining was darker, but the pTRV1+pTRV2-MuMADS1+pTRV2-MaMADS55 experimental group had the darkest staining ( image 3 A). The results indicated that both MuMADS1 and MaMADS55 could inhibit starch degradation, but the co-transformation of MuMADS1 and MaMADS55 had the best inhibitory effect on starch degradation.
[0055] (2) Fluorescent quantitative PCR
[0056] Total RNA in infected banana fruit slices was extracted using polysaccharide polyphenol plant total RNA extraction kit (Tiangen, DP441, Beijing, China) and RNase-free DNase (NEB, M0303S, USA). First-strand cDNA was synthesized using the RevertAid First-Strand cDNA Synthesis Kit, and further diluted 20 μL at a ratio of 1:50, and reverse-transcribed using a Nanodrop 2000 (Thermo Scientific, Waltham, MA, USA). On the Stratagene Mx3000P Real-TimePCR system, using Premix Ex Taq TM (TaKaRa, Japan), quantified by qRT-PCR analysis by the method of 2–ΔΔCt (Livak and Schmittgen, 2001). MaRPS2 (HQ853246) and MaUBQ2 (HQ853254) were used as internal references (Chen et al., 2011).
[0057] see results image 3. In the pTRV1+pTRV2-MaMADS55 transformation experiment group, the expression of endogenous MaMADS55 was suppressed, and the expression of MuMADS1 was also slightly reduced, and the expression of MuMADS1 was also slightly reduced, compared with CK, the expression of endogenous MaGWD1 was reduced by 0.03. was also inhibited, by 0.15 relative to CK. In the pTRV1+pTRV2-MuMADS1 transformation experiment group, the expression of endogenous MaMADS55 was inhibited, and the expression of MuMADS1 was also significantly inhibited, and the expression of endogenous MaGWD1 was decreased by 0.54 compared with CK. was also significantly inhibited, by 0.46 relative to CK. In the pTRV1+pTRV2-MuMADS1+pTRV2-MaMADS55 transformation experiment group, the expression of endogenous MaMADS55 was inhibited, with a decrease of 0.67 relative to CK, and the expression of MuMADS1 was also significantly inhibited, with a decrease of 0.64 relative to CK. The important thing is that the endogenous The expression of sex MaGWD1 was also significantly suppressed, which was reduced by 0.73 ( image 3 E). These results suggest that MaMADS55 and MuMADS1 can coordinately regulate the expression of MaGWD1.
[0058] (3) Determination of physiological indicators
[0059]The total starch content was determined according to the method of Miao et al. (2014). Glucan-water dikinase (GWD) activity was measured according to the method of Hou et al. (2017). The content of soluble sugars (fructose, glucose and sucrose) was analyzed using high performance liquid chromatography (HPLC; Waters, Milford, CT, USA) (Duarte-Delgado et al., 2015). All experiments were repeated three times, and all data are expressed as the mean ± standard error (S.E.) of three or six independent biological replicates. Statistical differences among samples were assessed by t-test (p<0.05).
[0060] see results image 3. The sucrose content of pTRV1+pTRV2-MaMADS55, pTRV1+pTRV2-MuMADS1 and pTRV1+pTRV2-MuMADS1+pTRV2-MaMADS55 transformation experimental groups were 12.46mg.g -1 FW, 8.50mg.g -1 FW, 5.18mg.g -1 FW and CK group 22.52mg.g -1 Compared with FW, it was reduced by 44.7%, 62.3% and 77.0%, respectively, and the glucose content was 4.88mg.g -1 FW, 4.10mg.g -1 FW, 2.12mg.g -1 FW, and CK group 5.62mg.g -1 Compared with FW, they were respectively reduced by 13.2%, 27.0% and 62.3%, and the fructose content was 4.35mg.g -1 FW, 3.62mg.g -1 FW, 2.82mg.g -1 FW, and CK group 5.16mg.g -1 Compared with FW, they were respectively reduced by 15.7%, 29.8% and 45.3% ( image 3 B).
[0061] On the contrary, the total starch content of the pTRV1+pTRV2-MaMADS55, pTRV1+pTRV2-MuMADS1 and pTRV1+pTRV2-MuMADS1+pTRV2-MaMADS55 transformation groups were 405.11mg.g -1 FW, 516.08mg.g -1 FW and 675.45 mg.g -1 FW, relative to CK 385.64 increased by 5.0%, 33.8% and 75.2%, respectively.
[0062] The GWD (glucan-water dikinase) activities of pTRV1+pTRV2-MaMADS55, pTRV1+pTRV2-MuMADS1 and pTRV1+pTRV2-MuMADS1+pTRV2-MaMADS55 experimental groups were 2.82nmol min -1 mg -1 、2.84nmol min - 1 mg -1 、2.10nmolmin -1 mg -1 , relative to CK group 3.61nmol min -1 mg -1 Respectively significantly reduced by 21.9%, 21.3% and 41.8% ( image 3 D).
[0063] These results indicated that MaMADS55 and MuMADS1 jointly regulate starch degradation by regulating the expression of MaGWD1.
