Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for changing soybean flower color by using CRISPR-Cas9 modified GmW1 gene

A flower color and genetically modified technology, applied in plant genetic improvement, genetic engineering, botanical equipment and methods, etc., can solve problems such as high cost, time-consuming and labor-intensive

Inactive Publication Date: 2021-06-04
INST OF CROP SCI CHINESE ACAD OF AGRI SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Soybean gene-edited plants are mainly identified through sequencing, and a large number of gene-edited detection tasks are time-consuming, laborious and costly

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for changing soybean flower color by using CRISPR-Cas9 modified GmW1 gene
  • Method for changing soybean flower color by using CRISPR-Cas9 modified GmW1 gene
  • Method for changing soybean flower color by using CRISPR-Cas9 modified GmW1 gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0073] Embodiment 1, the construction of GmW1 gene knockout vector

[0074] The nucleotide sequence of the genome of soybean GmW1 (Glyma.13G072100) is sequence 1 in the sequence listing. The GmW1 gene is located on chromosome 13, and the CRISPR-P (http: / / cbi.hzau.edu.cn / cgi-bin / CRISPR) online web tool was used to select the sgRNA target site sequence of the GmW1 gene. The target site is located in the first exon region of the GmW1 gene, and the target sequence is CTATCGCCAGAAACTCCCACCGG (positions 633-655 of Sequence 1). After the target is designed, it needs to be integrated into the carrier, as follows:

[0075] 1. Synthesis and annealing to prepare sgRNA

[0076] Synthesize the target primer of sgRNA, the primer sequence is:

[0077] W1-F: 5′-TTG CTATCGCCAGAAACTCCCAC -3'

[0078] W1-R: 5′-AAC GTGGGAGTTTCTGGCGATAG -3'

[0079] (The underlined sequence is 20bp sgRNA)

[0080] Add 5ul of W1-F and W1-R primers to the 25ul system, 15ul of water, anneal at 95°C for 3min...

Embodiment 2

[0090] Example 2, GmW1 gene knockout soybean and its phenotype

[0091] Using the Agrobacterium-mediated method to transform the constructed EHA-W1-sgRNA into the purple flower soybean variety Zhonghuang42 (wild type soybean), the specific method is as follows:

[0092] 1. Seed sterilization

[0093] 1. Take the seeds of soybean variety Zhonghuang42 (hereinafter referred to as wild-type soybean) that are plump, uniform, and dry without damage by diseases and insect pests and spots, and spread them completely in a petri dish, and then put the petri dish into a desiccator.

[0094] 2. After completing step 1, put a 100ml beaker in the desiccator, pour 80ml of 12M sodium hypochlorite aqueous solution into the beaker, then slowly add 4ml of concentrated hydrochloric acid, then quickly cover the desiccator, seal it with Vaseline, and place it for 12- 16h, carry out chlorine gas sterilization.

[0095] 2. Preparation of infection solution

[0096] 1. Cultivate EHA-W1-sgRNA Agroba...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for changing soybean flower color by using a CRISPR-Cas9 modified GmW1 gene. The invention provides an application of a substance for reducing the activity or content of protein W1 in changing the plant flower color, or an application of a substance for inhibiting expression of a nucleic acid molecule for encoding the protein W1 in changing the plant flower color; and the protein W1 is obtained by encoding a DNA molecule shown in a sequence 1 in a sequence table. Experiments prove that the W1 gene of daidzein 3' 5'-hydroxylase is related to the flower color, and the gene is edited to terminate expression, so that purple flowers can be changed into white flowers, and the plant flower color is changed.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to a method for modifying soybean flower color by using CRISPR-Cas9 to modify GmW1 gene. Background technique [0002] In recent years, gene editing technologies such as CRISPR / Cas9 have shown great application prospects. As an important crop, soybean can be edited for its important trait genes to create specific mutation materials, which can provide new materials for soybean genetic breeding. The creation of soybean mutants based on CRISPR / Cas9 is mainly through the transformation of soybean cotyledon nodes mediated by Agrobacterium tumefaciens. Most of the T0 transgenic plants obtained by this method are chimeras, and the homozygous transgenic plants are obtained at least from the T1 generation. [0003] Soybean gene-edited plants are mainly identified through sequencing, and a large number of gene-edited detection tasks are time-consuming, laborious and costly. Contents of the inven...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/82C12N15/53C12N9/02C12N15/113A01H5/02A01H6/54
CPCC12N15/8218C12N15/827C12N9/0073C12N15/113C12Y114/13088C12N2310/20
Inventor 侯文胜陈莉袁珊孙石
Owner INST OF CROP SCI CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com