RNA for improving low-temperature tolerance of plants and application thereof

A low temperature tolerance, plant technology, applied in the direction of DNA / RNA fragments, applications, plant peptides, etc., can solve the problems of lack of cassava low temperature resistant cultivars, long breeding cycle, affecting cassava yield and quality, etc.

Active Publication Date: 2021-08-03
INST OF TROPICAL BIOSCI & BIOTECH CHINESE ACADEMY OF TROPICAL AGRI SCI
View PDF8 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005]Due to the shortage of cassava cultivars resistant to low temperature, coupled with the limitations of many factors such as long breeding cycle, hybrid incompatibility, and failure to meet the flowering period in the traditional hybrid breeding method, resulting in At present, the cultivation of low temperature resistant cassava varieties lags behind
In the past, transcriptome analysis and transgenic technology have been used to obtain a large number of protein-coding genes that respond to low temperature stress and have regulatory functions under low temperature stress, but the high / low expression of these genes often affects the yield and quality of cassava

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • RNA for improving low-temperature tolerance of plants and application thereof
  • RNA for improving low-temperature tolerance of plants and application thereof
  • RNA for improving low-temperature tolerance of plants and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0021] Referring to the accompanying drawings, the present invention will be further described in conjunction with specific embodiments, so as to better understand the present invention. If no specific technique or condition is indicated in the examples, it shall be carried out according to the technique or condition described in the literature in this field or according to the product specification. The reagents or instruments used were not indicated by the manufacturer, and they were all commercially available conventional products.

[0022] 1. Acquisition of CRR2 gene

[0023] Total RNA was extracted from the leaves of cassava variety TMS60444, cDNA obtained by reverse transcription of PolyT was used as template, and CRR2-S primer: GGATCCAAATTTAACACGGTTGATTCAC and CRR2-A primer: GTCGACTCGGGATTCACTTTACCTTCTAG were used as primers to amplify the CRR2 gene by PCR method. Its sequence is shown in SEQID No: 1 (with restriction endonuclease cutting sites of BamH I and Sal I).

...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a CRR2 gene for improving low-temperature tolerance of plants. The nucleotide sequence of the CRR2 gene is shown as SEQ ID NO:1. The invention also provides RNA (Ribonucleic Acid) correspondingly transcribed by the CRR2 gene and application of the RNA. The CRR2 gene and the corresponding transcribed RNA of the CRR2 gene can specifically respond to low-temperature stress response. The subcellular localization analysis shows that the fluorescent probe is localized in cell nucleus and cytoplasm. The CRR2 gene is further transferred into cassava, a cassava CRR2 high-expression strain is obtained, it is found that the CRR2 high-expression strain is more tolerant to low-temperature stress, the survival rate is greatly increased, meanwhile, the proline content in the CRR2 high-expression strain is remarkably increased, the malondialdehyde (MDA) content after low-temperature treatment is remarkably reduced, it is indicated that the CRR2 and the CRR2 gene can improve the low-temperature tolerance of plants, and in the future, the plant is subjected to genetic improvement by using the gene, and an effective resource can be provided for improving the low-temperature tolerance of the plant.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to an RNA for improving low temperature tolerance of plants and an application thereof. Background technique [0002] Cassava (Manihot esculenta) is an important food and energy crop in the world. Its storage root is rich in starch, and it is the main source of food for nearly 800 million people in tropical and subtropical regions of the world. Our country is mainly alcohol and feed raw materials, and to meet the diversified needs of national food, the self-sufficiency rate is only 20%. Cultivated cassava has extraordinary light, heat and water utilization efficiency in the long-term evolution and artificial selection process, and its biomass production per unit area is higher than that of almost all other cultivated crops. features. However, since most of the world's hot spots are developing countries, the level of scientific and technological investment and research on c...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/29C12N15/11C12N15/82A01H5/00A01H6/38
CPCC07K14/415C12N15/8273
Inventor李淑霞程志号赵平娟于晓玲邹良平彭明
OwnerINST OF TROPICAL BIOSCI & BIOTECH CHINESE ACADEMY OF TROPICAL AGRI SCI