Unlock instant, AI-driven research and patent intelligence for your innovation.

A type A Seneca virus sva/heb full-length infectious cdna clone and its preparation method and application

An infectious and viral technology, applied in the field of viruses, can solve the problems of expensive, complicated operation, unstable reagents, etc., and achieve the effects of high rescue ability, high cloning efficiency, and high startup efficiency.

Active Publication Date: 2022-07-29
HEBEI AGRICULTURAL UNIV.
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In the RNA transfection strategy, the viral RNA is transcribed and synthesized in vitro, using the T7 or SP6 prokaryotic promoter, the viral RNA is transcribed in vitro, and then transfected into cells to start the rescue process of the virus, but this method The operation is cumbersome, unstable and the reagents are expensive

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A type A Seneca virus sva/heb full-length infectious cdna clone and its preparation method and application
  • A type A Seneca virus sva/heb full-length infectious cdna clone and its preparation method and application
  • A type A Seneca virus sva/heb full-length infectious cdna clone and its preparation method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] Construction of Seneca Recombinant Virus Infectious Clones

[0047] Seneca virus type A SVA / HeB (GenBank accession number: MZ375462) was isolated and preserved in this experiment. Based on the SVA genome sequence, through comparative analysis, design amplification primers that introduce rescue elements and cover the entire SVA genome:

[0048] SVA-AF: 5'-CATCATTTTGGCAAAGTGTTAAGCGTCTGATGAGTCCGTGAGGACGAAACTATAGGAAAGGAATTCCTATAGTCTTGAAATGGGGGGCTGGGCCCTCAT-3' (SEQ ID NO. 1);

[0049] SVA-AR: 5'-AGGTCCAACTAGAGTTCAAGCCTATG-3' (SEQ ID NO. 2);

[0050] SVA-BF: 5'-CACAACCACAGACCCTTTCTGAA-3' (SEQ ID NO. 3);

[0051] SVA-BR: 5'-TGCATTTCCATAAGAGAGAGCGCTC-3' (SEQ ID NO. 4);

[0052] SVA-CF: 5'-TAGGAGCGAGAATGCTTATGACGGC-3' (SEQ ID NO. 5);

[0053] SVA-CR: 5'-TACCAGATCTGAATCGCCCTCCCTTAGCCATCCGAGTGGACGTGCGTCCTCCTTCGGATGCCCAGGTCGGACCGCGAGGAGGTGGAGATGCCATGCCGACCCTTTTCCCTTTTCTGTTCCGAC-3' (SEQ ID NO. 6);

[0054] In the above specific primers, the EcoR I restriction site homology arm ...

Embodiment 2

[0059] The rescue procedure of recombinant Seneca virus is as follows:

[0060] The recombinant plasmid pOK-rSVA / HeB obtained from Example 1 was inoculated into BHK-21 cells in a 6-well plate. When the cells grew to 80%, they were used for transfection. Under the mediation of X-tremeGENE HPDNATransfection Reagent (Roche), 3ug The recombinant plasmid was transfected into BHK-21 cells, and a transfection reagent control and a normal cell control were established at the same time, and placed in 5% CO containing 2 In a 37°C incubator, observe the cell state and cytopathic conditions, harvest the virus when about 80% to 90% of the cells are diseased, and inoculate BHK-21 cells again after repeated freezing and thawing 3 times until the virus can stably produce cells Lesions with rounded, sloughed cells, and a large number of floating dead cells. The resulting recombinant virus was named rSVA-HeB, in image 3 In, A: picture of normal control BHK-21 cells; B: BHK-21 infected with r...

Embodiment 3

[0062] Culture characteristics of recombinant Seneca virus rSVA / HeB in different cells:

[0063] (1) The recombinant Seneca virus rSVA / HeB strain rescued in Example 2 was infected with PK-15 cells and caused typical cytopathic changes, which were similar to the culture characteristics of the wild parental strain SVA / HeB strain. The lesions caused by rSVA / HeB strain on PK-15 cells are as follows: Figure 4 shown, wherein A: picture of normal control PK-15 cells; B: rescued recombinant virus rSVA / HeB infected PK-15.

[0064] (2) The recombinant Seneca virus rSVA / HeB strain rescued in Example 2 was infected with IBRS-2 cells, and typical cytopathic changes were observed, which were similar to the culture characteristics of the wild parental strain SVA / HeB strain. The lesions caused by rSVA / HeB strain on IBRS-2 cells are as follows: Figure 5 shown, wherein A: picture of normal control IBRS-2 cells; B: rescued recombinant virus rSVA / HeB infected with IBRS-2.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a type A Seneca virus SVA / HeB full-length infectious cDNA clone and a preparation method and application thereof, and belongs to the field of virus technology. The rescue system used in the present invention introduces a CMV enhancer, a β-actin promoter and a ribozyme sequence upstream of the 5' end of Seneca virus type A; a ribozyme and a terminator sequence are introduced downstream of the 3' end, and are analyzed by RT-RCR method. The SVA full-length genome fragment was amplified by segment, cloned into pOK12 vector by homologous recombination technology, and a recombinant plasmid containing SVA / HeB full-length cDNA was constructed. The virus rescued based on infectious cDNA clones has laid a foundation for the in-depth study of the biological characteristics, replication mechanism, pathogenic mechanism of SVA and the development of related vaccines, and has important scientific application value.

Description

technical field [0001] The invention belongs to the field of virus technology, in particular to a Seneca virus type A SVA / HeB full-length infectious cDNA clone and a preparation method and application thereof. Background technique [0002] Senecavirus A (Senecavirus A, SVA) is a member of the genus Senecavirus of the Picornaviridae family, and is a single-stranded positive-stranded RNA virus without an envelope. It has been confirmed that SVA-infected pigs can cause primary vesicular disease, causing vesicular lesions on the snout and hoof coronal zone of pigs, accompanied by clinical manifestations such as lameness, anorexia, lethargy and fever. It is indistinguishable from clinical symptoms caused by foot-and-mouth disease, swine vesicular disease, and vesicular stomatitis. [0003] In 2002, American scientists first discovered SVA in cell culture. After 2015, SVA outbreaks occurred in Canada, the United States, Brazil, Thailand, China and other countries. Through retro...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/41C12N15/63C12N7/01C12N15/11
CPCC07K14/005C12N15/63C12N7/00C12N2770/32021C12N2770/32022C12N2770/32051
Inventor 袁万哲郭笑然赵款雷白时张武超刘小娜
Owner HEBEI AGRICULTURAL UNIV.