Unlock instant, AI-driven research and patent intelligence for your innovation.

Structural domain for improving high-temperature-resistant stability of keratinase and application of structural domain

A technology of keratinase and stability, which is applied to improve the high temperature stability of keratinase and its application field, and can solve the problems of not meeting industrial needs and single varieties

Active Publication Date: 2021-09-03
THE INST OF BIOTECHNOLOGY OF THE CHINESE ACAD OF AGRI SCI
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, the variety of enzyme preparations produced in China is relatively single, which cannot meet the needs of industry, so it is still necessary to develop high-quality enzyme resources with special properties

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Structural domain for improving high-temperature-resistant stability of keratinase and application of structural domain
  • Structural domain for improving high-temperature-resistant stability of keratinase and application of structural domain
  • Structural domain for improving high-temperature-resistant stability of keratinase and application of structural domain

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0069] This example is used to illustrate the functional identification of keratinase DgeKer

[0070] (1) Experimental method

[0071] 1. Construction of keratinase expression strain

[0072] Design PCR-specific primers based on the genome sequence of Deinococcus thermophila:

[0073] Dgeker-F: ACCCATATGAACTCACGTCTTGCGCTTG (SEQ ID NO. 11)

[0074] Dgeker-R: ACCCTCGAGTGGTGTAGAGCAGGCGGTTGGG (SEQ ID NO. 12)

[0075] The target gene sequence was amplified from the genomic DNA of Deinococcus thermophiles by PCR method.

[0076] PCR reaction program:

[0077]

[0078] After the PCR product was recovered by gel, it was connected to the pET-28a vector containing cohesive ends obtained by Nde I / Xho I double digestion by recombinase to construct the E. coli expression vector pET28a-DgeKer. The expression vector was transformed into Escherichia coli BL21(DE3), and the inserted sequence was verified to be correct by PCR, enzyme digestion and sequencing, and the strain was named BL...

Embodiment 2

[0097] This example is used to illustrate the mining and analysis of keratinase thermostability functional domain Asn240-Tyr274

[0098] (1) Experimental method

[0099] Bioinformatics Analysis

[0100] The similarity analysis and comparison of databases were carried out by using BLAST. The molecular weight and extinction coefficient of the protein were analyzed using ProtParam on the ExPASy server. Using ESPript3.0 amino acid sequence alignment, for secondary structure analysis. The 3D structure of DgeKer was predicted using Phyre2server. Use VMD1.9.3 to visualize and edit PDB files generated by Phyre2. The protein structure domain and catalytic center of DgeKer were predicted by Interpro software. The phylogenetic tree was constructed by the neighbor-joining method using MEGA 7.0 software. SCHEMA software was used for hotspot domain analysis and protein modular recombination.

[0101] (2) Experimental results

[0102] Bioinformatics analysis shows that the mature reg...

Embodiment 3

[0105] This example is used to illustrate the application of the functional domain Asn240-Tyr274 in the optimization of keratinase

[0106] (1) Experimental method

[0107] 1. Construction of recombinant keratinase expression strain with functional domain Asn240-Tyr274

[0108] Using the method of synthetic biology, using Deinococcus Gobi keratinase KerDG1 as a template, the Asn240-Tyr274 fragment of the keratinase DgeKer functional domain was artificially designed to replace the KerDG1 homologous structure Asn243-Tyr276, and the recombinant gene was named KerDG1-AT.

[0109] The Escherichia coli expression vector pET28a-KerDG1-AT was constructed by linking with the pET-28a vector by recombinase. The expression vector was transformed into Escherichia coli BL21(DE3), and the inserted sequence was verified to be correct by PCR, enzyme digestion and sequencing, and the strain was named BL21-KerDG1-AT.

[0110] 2. Induced expression and purification of functional domain Asn240-T...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an artificially modified keratinase with high-temperature-resistant stability, a separated keratinase, a fragment of the separated keratinase, a separated or artificially synthesized nucleic acid, a recombinant vector inserted into the gene, and a transformant transformed with the gene. The invention discloses a method for improving high-temperature-resistant stability of keratinase and a method for degrading feather by using the keratinase. According to the invention, amino acid optimization of the keratinase gene fragment is realized, the high-temperature-resistant effect of keratinase is improved, and more improvement strategies are provided for optimization of keratinase for industry and environment.

Description

technical field [0001] The present disclosure relates to the field of genetic engineering, in particular, to an artificially modified keratinase with high temperature stability, an isolated keratinase, a fragment of an isolated keratinase, an isolated or artificially synthesized nucleic acid, A recombinant vector inserted with the gene, a transformant transformed with the gene, a method for improving the high-temperature stability of keratinase and a method for degrading feathers with the keratinase. Background technique [0002] Keratinase is a class of enzymes that can specifically attack keratin disulfide bonds and degrade keratin, mainly produced by bacteria. Structural analysis showed that keratinase contained signal peptide, N-terminal propeptide and mature region, and part of the sequence contained C-terminal extension structure. The mature region of keratinase is also called the catalytic domain, which consists of seven parallel β-sheets and six α-helices in the cen...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/54C12N15/57C12N15/70C12N1/21C14C1/06C12R1/19
CPCC12N9/54C12N15/70C14C1/065
Inventor 林敏周正富张维唐殷王劲
Owner THE INST OF BIOTECHNOLOGY OF THE CHINESE ACAD OF AGRI SCI