Structural domain for improving high-temperature-resistant stability of keratinase and application of structural domain
A technology of keratinase and stability, which is applied to improve the high temperature stability of keratinase and its application field, and can solve the problems of not meeting industrial needs and single varieties
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0069] This example is used to illustrate the functional identification of keratinase DgeKer
[0070] (1) Experimental method
[0071] 1. Construction of keratinase expression strain
[0072] Design PCR-specific primers based on the genome sequence of Deinococcus thermophila:
[0073] Dgeker-F: ACCCATATGAACTCACGTCTTGCGCTTG (SEQ ID NO. 11)
[0074] Dgeker-R: ACCCTCGAGTGGTGTAGAGCAGGCGGTTGGG (SEQ ID NO. 12)
[0075] The target gene sequence was amplified from the genomic DNA of Deinococcus thermophiles by PCR method.
[0076] PCR reaction program:
[0077]
[0078] After the PCR product was recovered by gel, it was connected to the pET-28a vector containing cohesive ends obtained by Nde I / Xho I double digestion by recombinase to construct the E. coli expression vector pET28a-DgeKer. The expression vector was transformed into Escherichia coli BL21(DE3), and the inserted sequence was verified to be correct by PCR, enzyme digestion and sequencing, and the strain was named BL...
Embodiment 2
[0097] This example is used to illustrate the mining and analysis of keratinase thermostability functional domain Asn240-Tyr274
[0098] (1) Experimental method
[0099] Bioinformatics Analysis
[0100] The similarity analysis and comparison of databases were carried out by using BLAST. The molecular weight and extinction coefficient of the protein were analyzed using ProtParam on the ExPASy server. Using ESPript3.0 amino acid sequence alignment, for secondary structure analysis. The 3D structure of DgeKer was predicted using Phyre2server. Use VMD1.9.3 to visualize and edit PDB files generated by Phyre2. The protein structure domain and catalytic center of DgeKer were predicted by Interpro software. The phylogenetic tree was constructed by the neighbor-joining method using MEGA 7.0 software. SCHEMA software was used for hotspot domain analysis and protein modular recombination.
[0101] (2) Experimental results
[0102] Bioinformatics analysis shows that the mature reg...
Embodiment 3
[0105] This example is used to illustrate the application of the functional domain Asn240-Tyr274 in the optimization of keratinase
[0106] (1) Experimental method
[0107] 1. Construction of recombinant keratinase expression strain with functional domain Asn240-Tyr274
[0108] Using the method of synthetic biology, using Deinococcus Gobi keratinase KerDG1 as a template, the Asn240-Tyr274 fragment of the keratinase DgeKer functional domain was artificially designed to replace the KerDG1 homologous structure Asn243-Tyr276, and the recombinant gene was named KerDG1-AT.
[0109] The Escherichia coli expression vector pET28a-KerDG1-AT was constructed by linking with the pET-28a vector by recombinase. The expression vector was transformed into Escherichia coli BL21(DE3), and the inserted sequence was verified to be correct by PCR, enzyme digestion and sequencing, and the strain was named BL21-KerDG1-AT.
[0110] 2. Induced expression and purification of functional domain Asn240-T...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


