Cytochrome P450 enzyme and application thereof in synthesis of ganoderma lucidum triterpenoids
A technology of cytochrome and Ganoderma lucidum triterpenes, applied in the direction of steroids, applications, and microbial-based methods, which can solve the problems of slow growth of the host
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0107] Construction of Saccharomyces cerevisiae strain overexpressing ganoderma acid HLDOA
[0108] The yeast expression plasmid pRS425-CYP5150L8-iGLCPR-Hygr was transformed into Saccharomyces cerevisiae YL-T3 to form Saccharomyces cerevisiae YL-T3-CYP5150L8-iGLCPR after recombinant transformation. The specific operation steps are as follows:
[0109] Construction of Yeast Expression Plasmid pRS425-CYP5150L8-iGLCPR-Hygr
[0110] 1.1) Transformation is carried out on the basis of pRS425-iGLCPR-Hygr. The pRS425-iGLCPR-Hygr plasmid can be obtained by referring to (Lan, Yuan, Wang, & Xiao, 2019). First, the plasmid pRS425-iGLCPR-Hygr was digested with Pmel enzyme to obtain a linearized plasmid vector fragment.
[0111] 1.2) Then use the primer pair HF-CYP5150L8-F and HF-CYP5150L8-R, with pRS426-HXT7p-CYP5150L8-FBA1t (Lan, X., et al., Biotechnol Bioeng, 2019.116(12):3301-3311) as a template The CYP5150L8de expression cassette containing homology arms was amplified. The specific ...
Embodiment 2
[0127] Construction of Saccharomyces cerevisiae Transformation Strains Expressing CYP Genes
[0128] 2.1) Using Ganoderma lucidum cDNA as a template, the sequence fragments of the CYP gene coding region were obtained by PCR amplification, and the coding region sequence fragments of GL20421 and GL21117 were SEQ ID No.1 and SEQ ID No.3, respectively. The primer sequences used to amplify and obtain the sequence fragments of the coding regions of the CYP genes GL20421 and GL21117 of Ganoderma lucidum from the cDNA of Ganoderma lucidum are shown in Table 3.
[0129] Table 3. List of primer sequences used to amplify Ganoderma lucidum CYP gene coding region sequence fragments
[0130] Primer name serial number Sequence(5'to 3') GL20421-F SEQ ID No.9 taattttaatcaaaaagtttatgatcatcccagtagacat GL20421-R SEQ ID No.10 attaatttgaattaacgttttcagtctgcacgacgcaccc GL21117-F SEQ ID No.11 taattttaatcaaaaagtttatggcgacgttggaggaccc GL21117-R SEQ ID No.1...
Embodiment 3
[0143] Example 3 Determination of CYP genes and functional identification by fermentation of yeast transformants
[0144] Fermentation of yeast transformed strains:
[0145] 3.1) The constructed transformants of yeast transformation strains containing CYP genes (GL20421 gene or GL21117 gene) were fermented, and an empty plasmid strain without CYP gene was used as a control. By comparing the differences of metabolites after fermentation, the CYP genes that may be related to the biosynthesis of Ganoderma lucidum triterpenes were preliminarily screened. The specific operation is as follows:
[0146]3.1.1) Transformants of the transformed yeast strains comprising CYP genes constructed in Example 2 were liquid-transferred into 3 mL of SC-His-Leu-Ura (SC-HLU) liquid medium (yeast nitrogen base without amino acids (YNB), 6.7g / L; glucose, 20g / L; yeast synthetic drop-out media (SD) Y2001, 1.39g / L; tryptophan, 76mg / L), placed in Qualcomm Cultivate in a shaker for 24 hours;
[0147] ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



