Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for inhibiting tau pathological prion transmission through mediation of adeno-associated viruses

A virus-mediated technology, applied in the field of biomedicine

Pending Publication Date: 2021-10-01
NANTONG UNIVERSITY
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Unfortunately, AD has always been the hardest-hit area for new drug development. The failure rate of clinical trials in this field is as high as 99.6%. In the past 20 years, the research in this field has almost been wiped out, so it is very necessary to find new targets

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for inhibiting tau pathological prion transmission through mediation of adeno-associated viruses
  • Method for inhibiting tau pathological prion transmission through mediation of adeno-associated viruses
  • Method for inhibiting tau pathological prion transmission through mediation of adeno-associated viruses

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0050] First, build RAAV9-PPP2CA virus

[0051] 1. Overgraduated vector construction, build processes such as figure 1 Down:

[0052] (1) Purpose gene and tool carrier information

[0053] Gene information:

[0054] Purpose Gene: PPP2CA (HA-NM_019411-T2A-EGFP)

[0055] Species: mouse

[0056] Vector information:

[0057] Vector Name: CV235

[0058] Component sequence: Hsyn Promoter-MCS-SV40 POLYA

[0059] Enzyme cleavage: Bamhi / Agei

[0060] (2) Objective of the target gene fragment:

[0061] Primers: p1: ggaggtagtggaatgatcccccccccatgtacccttatgatgtcccagactatgctgg

[0062] P2: gttgattatcgataaccgggttctTgtacagctcgtcccatgccg

[0063] PCR product size: 1802

[0064] (3) Analysis of sequencing results of recombinant plasmid construction and positive clonal sequencing

[0065] Compare the results meet the requirements

[0066] ccaccgcgaggcgcgagataggggggcacgggcgcgaccatctgcgctgcggcgccggcgactcagcgctgcctcagtctgcggtgggcagcggaggagtcgtgtcgtgcctgagagcgcagtcgagaaggtaccggaattcggaactggaggtggaggta...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for inhibiting tau pathological prion transmission through mediation of adeno-associated viruses. The method comprises the following steps: constructing a recombinant adeno-associated virus; injecting the constructed adeno-associated virus into the right ventricle of a mouse in a ventricle injection manner; separating pathological tau, namely AD O-tau, extracted from the brain of an AD patient; and injecting the separated AD O-tau into the hippocampus of the mouse. Results show that rAAV9 can be used as an effective tool vector for delivering genes in brain tissues, over-expression of a PP2A gene is mediated through a virus vector, and dephosphorylation of tau is increased, so a molecular mechanism of tau pathogenesis is studied, the relationship between tau pathology aggregation and prion transmission and tau phosphorylation level and PP2A is defined, the feasibility of rAAV vector mediated gene therapy is prompted, the screening of drugs for inhibiting or reversing the generation, development and transmission of tau pathology can be facilitated, and a new strategy is provided for the treatment of such diseases.

Description

Technical field [0001] The present invention belongs to the field of biomedical technology, and more particularly to a method of suppressing TAU pathological propagation by an additional virus. Background technique [0002] Alzheimer Disease (AD), commonly known as senile dementia, multi-factor disease, aging is its most important cause. AD has a typical pathological characteristics: extracellular beta-amyloidprotein (β-amyloidprotein, deposition formed by Senile Plaque, SP) and a large number of Tau proteins in cells forming neurofibrillary tangles (Neurofibrillary Tangles) , NFTS) and a wide range of neurons. It has always been in the field of AD research as a focus on Aβ as a focus on the development of drug development. Unfortunately, AD has always been a hitting area developed by new drugs. The clinical trial failure rate of this field is as high as 99.6%. In the past 20 years, it has not been covered in this field, so it is necessary to find new targets. [0003] The number...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/864C12N15/55G01N33/68
CPCC12N15/86C12N9/16C12Y301/03G01N33/6842C12N2750/14143
Inventor 周艳周鼎伟吴若桢
Owner NANTONG UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com