Supercharge Your Innovation With Domain-Expert AI Agents!

Multiplex RT-PCR (Reverse Transcription-Polymerase Chain Reaction) primer probe group for real-time fluorescent quantitative detection of four porcine diarrhea viruses, kit and detection method

A RT-PCR, real-time fluorescent quantitative technology, applied in the field of real-time fluorescent RT-PCR detection, can solve the problems that cannot meet the early detection of low-copy viruses, so as to improve the level of virus detection, reduce the occurrence of false negatives, and support timely early warning Effect

Pending Publication Date: 2021-10-01
HEBEI UNIV OF ENG
View PDF6 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the sensitivity of the existing multiple common RT-PCR detection is 10 4 ~10 3 About copies, this sensitivity cannot meet the early detection of low copy virus amount, so on the basis of ensuring the specificity, sensitivity and repeatability of the experiment, explore and establish a set of multiple fluorescent quantitative RT-PCR detection methods for the above four porcine diarrhea viruses , helps to improve the level of virus detection, and has important application prospects in the diagnosis, prevention and control of diarrheal diseases, and food safety.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Multiplex RT-PCR (Reverse Transcription-Polymerase Chain Reaction) primer probe group for real-time fluorescent quantitative detection of four porcine diarrhea viruses, kit and detection method
  • Multiplex RT-PCR (Reverse Transcription-Polymerase Chain Reaction) primer probe group for real-time fluorescent quantitative detection of four porcine diarrhea viruses, kit and detection method
  • Multiplex RT-PCR (Reverse Transcription-Polymerase Chain Reaction) primer probe group for real-time fluorescent quantitative detection of four porcine diarrhea viruses, kit and detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0053] This example relates to the design of multiplex RT-PCR primer probe sets for real-time fluorescent quantitative detection of four porcine diarrhea viruses, the preparation of positive control clone plasmids in the multiplex RT-PCR kit, kit assembly and detection application of the kit.

[0054] 1. Design of primer-probe sets for four porcine diarrhea viruses

[0055] (1) The gene sequence of the positive fragment of the virus is as follows;

[0056] Porcine epidemic diarrhea virus M gene amplified sequence (133bp):

[0057] CGGTTCTATTCCCGTTGATGAGGTGATTGAACACCTTAGAAACTGGAATTTCACATGGAATATCATACTGACGATACTACTTGTAGTGCTTCAGTATGGCCATTACAAGTACTCTGTGTTCTTGTATGGTGTC, which is the sequence of SEQ ID NO: 13;

[0058] Porcine transmissible gastroenteritis virus S gene amplified sequence (151bp):

[0059] GCATATTACCACAATTTGCCTCTGAATTAGAAGGACATATAGGGAACTTATGGTTTAACCTGCACTCACTACCCCCAATTGCAAGTCAAACTAGATTCTGTGGTGGTAGTAGGTGGTGAGCCCTTACAAATGCATATAATAGCACCTTCAGC, which is the sequence of S...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a multiplex RT-PCR (reverse transcription-polymerase chain reaction) primer probe group for real-time fluorescent quantitative detection of four porcine epidemic diarrhea viruses. The multiplex RT-PCR primer probe group comprises an upstream primer, a downstream primer and a specific fluorescent probe of a porcine epidemic diarrhea virus M gene, an upstream primer, a downstream primer and a specific fluorescent probe of a swine transmissible gastroenteritis virus S gene; an upstream primer, a downstream primer and a specific fluorescent probe of a porcine rotavirus VP6 gene; and an upstream primer, a downstream primer and a specific fluorescent probe of a porcine D-type coronavirus M gene. The kit assembled on the basis of the primer probe group has the advantages of high sensitivity, high specificity, low pollution and real-time detection, and provides a reliable technology and product for early warning, early diagnosis and prevention and control monitoring of clinical diarrhea virus in a first-line pig farm.

Description

technical field [0001] The invention relates to the technical field of real-time fluorescent RT-PCR detection, in particular to a multiplex RT-PCR primer probe set and kit for real-time fluorescent quantitative detection of four porcine diarrhea viruses, and a detection method for the kit. Background technique [0002] Porcine epidemic diarrhea virus (PEDV), porcine D-coronavirus (PDCoV), porcine transmissible gastroenteritis virus (TGEV), porcine rotavirus (PoRV) ) are the four main pathogens. Because the diseases caused by PEDV, PDCoV, TGEV and PoRV have similar clinical symptoms, and there are often problems of mixed infection and secondary infection, it increases the morbidity and mortality of pig herds and seriously endangers the healthy development of the pig industry. Further strengthening pathogen monitoring and doing a good job in comprehensive prevention and control of vaccine immunization, feeding management, and biosecurity are effective ways to continuously red...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/686C12N15/11
CPCC12Q1/701C12Q1/686C12Q2600/16C12Q2600/166C12Q2537/143C12Q2563/107C12Q2545/113C12Q2521/107Y02A50/30
Inventor 韩冬梅王方方元娜安川叶马腾壑
Owner HEBEI UNIV OF ENG
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More