A kind of long non-coding RNA and its application as a molecular marker of multiple myeloma cells
A multiple myeloma, long-chain non-coding technology, applied in the field of monitoring the progress of multiple myeloma, achieving the effect of good repeatability, accurate detection, and low cost
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0064] 1. 8 cases of bone marrow from patients with multiple myeloma and 2 cases of normal bone marrow were received with 5ml of bone marrow each. After CD138 cells were extracted, the specimens were sent for inspection, and new lncRNAs were screened by RNA sequencing. The results are as follows: figure 1 , predicting its target genes and their GO functions and KEGG biological pathway enrichment analysis ( figure 2 ); candidate miRNAs and mRNAs predicted to interact with lncRNA MSTRG.29039.1 ( Figure 5 A, B).
[0065] 2. Put 3ml of lymphocyte separation solution in a 15ml centrifuge tube, add bone marrow fluid slowly on it, centrifuge at 20°C and 2000rpm for 20 minutes; aspirate the supernatant and collect the mononuclear cell layer (buffy coat) in PBS containing 10ml centrifuge at 1500 rpm for 5 minutes; discard the supernatant, resuspend, count, and centrifuge every 10 7MNCs were resuspended in 80 μl PBS buffer, 20 μl anti-CD138 antibody was added, mixed well and incubat...
Embodiment 2
[0083] An auxiliary diagnosis kit for the progression of multiple myeloma, the kit includes:
[0084] (1), bone marrow mononuclear cell separation reagent (purchased from Solarbio company), multiple myeloma cell CD138 magnetic beads (purchased from Miltenyi Biotec company);
[0085] (2) Specific primers and probes for transcript DNA of lncRNA MSTRG.29039.1;
[0086] (3) Specific primers and probes for GapDH internal reference markers;
[0087] (4), reverse transcriptase, qPCR Mix, 10mM dNT Ps, reverse transcription buffer, RNase inhibitor (purchased from Tiangen company), DEPC water;
[0088] (5), total RNA extraction reagent Trizol (purchased from InvitrogenTM), isopropanol, absolute ethanol, chloroform, PB buffer.
[0089] The specific primers of lncRNA MSTRG.29039.1 are: upstream primer (5'to3'): ACGGAAACAGCCCTGCCTTC (SEQ ID NO:2); downstream primer (5'to3'): CCCTCTCCCTCTCCTGTTGTGG (SEQ ID NO:3).
[0090] The specific primers for the GAPDH internal reference marker are: ...
Embodiment 3
[0092] Human MM cell lines (U266 and AMO-1 cells) were cultured in RPMI-1640 medium supplemented with 10% fetal bovine serum (FBS) and 1% streptomycin-penicillin in a humidified 37°C with 5% CO 2 in the cell incubator. Seed logarithmically grown MM cells into 6-well plates at approximately 1 x 10 per well 6 Cells were transiently transfected with Lipofectamine 3000 reagent according to the manufacturer's instructions. Positive, fluorescent and negative controls (NC) for lncRNA MSTRG.29039.1 (si-MSTRG.29039.1:sense(5'-3')GGAUCGGAAAUGAGAAAUUTT, antisense(5'-3')AAUUUCUCAUUUCCGAUCCTT) were purchased from GenePharma. The specific operations are as follows: Inoculate the cells in 500 μl of antibiotic-free medium, and make them grow to 30-50% confluence during transfection. 2. Preparation of transfection solution, the amount of cells per well is as follows: A. Use 50 μl Opti-MEM low Dilute 20pmol siRNA in serum medium (or other serum-free medium) (the final concentration of siRNA d...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More