CDC20-based high-temperature-resistant cell obtaining method and obtained high-temperature-resistant cell
A 1.CDC20, high temperature resistant technology, applied in the field of biomedicine, can solve problems such as limitation, achieve the effect of solving the increase of regulation and good clinical application value
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1、39
[0053] Example 1. Detection of cell phenotype after high temperature treatment of human mesenchymal stem cells at 39°C
[0054] 1.1 High temperature treatment at 39°C promotes the apoptosis of mesenchymal stem cells
[0055] Wild-type human mesenchymal stem cells (hMSCs) were transferred to gelatin-coated six-well plates at a density of 1E5. After the medium was changed the next day, the cells were divided into two groups and placed in incubators at 37°C and 39°C for 48 hours. Apoptosis detection was performed using an apoptosis detection kit.
[0056] In this experiment, the Annexin V-EGFP cell apoptosis detection kit from Weiglass Company was used.
[0057] This kit contains the following materials:
[0058] name quantity Storage Conditions Annexin V-EGFP 40 / 100μl 4℃ Propidium Iodide (PI) 10 / 25μl 4℃ 4x Annexin V Binding Bufer 5 / 15μl 4℃
[0059] The specific method for detecting apoptosis is as follows:
[0060] 1.1.1. Preparation...
Embodiment 2
[0087] Example 2, human mesenchymal stem cells knocked out of CDC20
[0088] The present application found that knocking down the CDC20 (cell division cycle 20) gene can simulate the cell phenotype of human mesenchymal stem cells, which is caused by high temperature treatment at 39°C, which promotes apoptosis and inhibits proliferation.
[0089] The experimental steps are as follows:
[0090] 2.1. Preparation of recombinant lentivirus for knocking down human CDC20 gene
[0091] 2.1.1. Screen the sgRNA sequence for knocking down the CDC20 gene from the GeCKOv2.0 (1000000048) plasmid library, as follows:
[0092] KO-sgCDC20-F: 5′-CACC GTTCCCTGCCAGACCGTATCC -3' (the underlined part is the same as the target sequence)
[0093] KO-sgCDC20-R: 5′-AAAC GGATACGGTCTGGCAGGGAAC -3' (the underlined part is the same as the target sequence)
[0094] The oligonucleotide sequence of the gRNA targeting the CDC20 gene was synthesized at GENEWIZ, Inc., and KO-sgCDC20-F was annealed with KO...
Embodiment 3
[0113] Example 3, human mesenchymal stem cells activated by CDC20 transcription
[0114] The present application found that using the CRISPR / dCas9 transcriptional activation system to activate the transcription of the CDC20 (cell division cycle 20) gene in hMSCs can resist the increased apoptosis and inhibition of proliferation of hMSCs caused by high temperature treatment at 39°C.
[0115] The experimental steps are as follows:
[0116] 3.1. Preparation of recombinant lentivirus that activates human CDC20 gene
[0117] 3.1.1 Screen the sgRNA sequence that activates the CDC20 gene from the sam-human plasmid library, as follows:
[0118] SAM-sgCDC20-F:5′-CACC GCAGTACTAGTCCTCTGGCGC -3' (the underlined part is the gene encoding the spacer of the sgRNA that recognizes the CDC20 gene)
[0119] SAM-sgCDC20-R: 5′-AAAC GCGCCAGAGGACTAGTACTGC -3' (the underlined part is the gene encoding the spacer of the sgRNA that recognizes the CDC20 gene)
[0120] The oligonucleotide sequence o...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com