Method for detecting activity of telomerase

A technology of telomerase and activity, applied in the detection of telomerase activity in cancer cells and its preparation of nano-fluorescent probes, and the detection of biomarkers in cancer cells, to simplify the detection system, reduce detection costs and sample usage Quantity, overcoming the effect of low detection sensitivity

Pending Publication Date: 2021-12-10
QINGDAO UNIV OF SCI & TECH
View PDF5 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, the use of S1 and S2 as blocking materials for porous nanocarriers to construct fluorescent probes for telomerase activity detection based on the amplification-multiple hybridization-cycling enzyme amplification strategy has not been reported in the literature.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting activity of telomerase
  • Method for detecting activity of telomerase
  • Method for detecting activity of telomerase

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] A method for preparing a novel fluorescent nanoprobe for detecting cancer cell telomerase activity based on the amplification-multiple hybridization-cycling enzyme amplification strategy using S1 and S2 as the blocking material of the porous carrier proposed by the present invention , including the following steps:

[0030] (1) Design and synthesize S1 and S2, whose sequences from 5' to 3' are: AATCCGTCGAGCAGAGTT and AATCCGTCGAGCAGAGTTCCCTAACCCTAA respectively;

[0031] (2) Prepare S1 and S2 solutions with a concentration of 20 μM respectively;

[0032] (3) Pipette 10 μL of the S1 and S2 solutions prepared in the previous step, respectively, and add them to 100 μL of the porous gold nanocarrier solution loaded with rhodamine B signal molecules, and shake at 37°C overnight;

[0033] (4) Magnetic separation, cleaning, and finally making the nano fluorescent probe of the present invention for detecting cancer cell telomerase activity;

[0034] (5) Disperse the product of...

Embodiment 2

[0037] A method for detecting telomerase activity in cancer cells using the nano fluorescent probe proposed by the present invention, comprising the steps of:

[0038] (1) 2.0mL containing HeLa cells 1.0×10 7 cell / mL culture solution, washed three times with PBS buffer (pH=7.4), then centrifuged at 2000rpm for 5min, added 200μL cell lysis buffer for 30min in ice bath, and finally at 4°C, 12000rpm Centrifuge for 20min to obtain cell lysate;

[0039] (5) In order to detect the activity of telomerase in the HeLa cell lysate, the cell lysate obtained above was diluted step by step to obtain solutions containing different numbers of cells. The specific number of cells includes: 70, 100, 200, 400, 600 , 800, 1000, 1100, 2000, 4000, 6000, 8000, 10000 cells;

[0040] (6) Mix the above-mentioned diluted cell lysate with 20 μL probe solution (10 nM), 1.0 μL EXOⅢ shearing enzyme (20 U / μL) and 10 μL dNTPs (10 mM), and dilute to 100 μL with PBS buffer;

[0041] (7) After incubating at 3...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
widthaaaaaaaaaa
Login to View More

Abstract

Telomerase can maintain the length of telomere by triggering amplification reaction, thereby causing cell immortalization and carcinogenesis. Research shows that telomerase is overexpressed in almost all cancer cells, so that telomerase becomes one of important biomarkers. Therefore, the development of a technology for sensitively detecting telomerase is of great significance for early diagnosis and treatment of tumors. The invention designs and develops a fluorescent probe for detecting the activity of telomerase based on blocking materials S1 and S2. A telomerase primer S1 capable of triggering repeated amplification reaction of telomerase and S2 capable of undergoing multiple hybridization reaction with an amplification product are adopted as the blocking materials of a porous nano-carrier to simulate and construct an intelligent lock, so that high-specificity and ultra-sensitive detection of the activity of telomerase in cancer cells is realized, the defects of low detection sensitivity, large sample demand, tedious steps, high cost and the like of a traditional method are overcome, and a new strategy and method are provided for living body and cell detection and in-situ imaging.

Description

technical field [0001] The invention relates to the detection of biomarkers in cancer cells, in particular to a nano fluorescent probe for detecting telomerase activity in cancer cells and its preparation method and application, belonging to the fields of photoelectrochemical biosensing analysis and biomedical clinical diagnosis. Background technique [0002] Studies have shown that telomeres and telomerase are closely related to cell aging, cell division, cell immortalization and cell malignant transformation, and are important factors for aging and tumors. Telomere is a nucleotide repeat sequence present at the end of most eukaryotic cell chromosomes. For humans, the telomere sequence (TTAGGG)n repeats about 2500 times. The length of the telomere itself will continue to shorten as the number of cell divisions increases, and the extremely short length makes the cells stop dividing and enter the stage of apoptosis and senescence. Therefore, the role of the telomere is equiv...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/48C12Q1/682C12N15/11
CPCC12Q1/485C12Q1/682G01N2333/9128C12Q2521/113C12Q2521/319C12Q2563/107C12Q2563/155C12Q2563/137
Inventor王卫秦力琳唐凯罗细亮
OwnerQINGDAO UNIV OF SCI & TECH