Method for detecting activity of telomerase
A technology of telomerase and activity, applied in the detection of telomerase activity in cancer cells and its preparation of nano-fluorescent probes, and the detection of biomarkers in cancer cells, to simplify the detection system, reduce detection costs and sample usage Quantity, overcoming the effect of low detection sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] A method for preparing a novel fluorescent nanoprobe for detecting cancer cell telomerase activity based on the amplification-multiple hybridization-cycling enzyme amplification strategy using S1 and S2 as the blocking material of the porous carrier proposed by the present invention , including the following steps:
[0030] (1) Design and synthesize S1 and S2, whose sequences from 5' to 3' are: AATCCGTCGAGCAGAGTT and AATCCGTCGAGCAGAGTTCCCTAACCCTAA respectively;
[0031] (2) Prepare S1 and S2 solutions with a concentration of 20 μM respectively;
[0032] (3) Pipette 10 μL of the S1 and S2 solutions prepared in the previous step, respectively, and add them to 100 μL of the porous gold nanocarrier solution loaded with rhodamine B signal molecules, and shake at 37°C overnight;
[0033] (4) Magnetic separation, cleaning, and finally making the nano fluorescent probe of the present invention for detecting cancer cell telomerase activity;
[0034] (5) Disperse the product of...
Embodiment 2
[0037] A method for detecting telomerase activity in cancer cells using the nano fluorescent probe proposed by the present invention, comprising the steps of:
[0038] (1) 2.0mL containing HeLa cells 1.0×10 7 cell / mL culture solution, washed three times with PBS buffer (pH=7.4), then centrifuged at 2000rpm for 5min, added 200μL cell lysis buffer for 30min in ice bath, and finally at 4°C, 12000rpm Centrifuge for 20min to obtain cell lysate;
[0039] (5) In order to detect the activity of telomerase in the HeLa cell lysate, the cell lysate obtained above was diluted step by step to obtain solutions containing different numbers of cells. The specific number of cells includes: 70, 100, 200, 400, 600 , 800, 1000, 1100, 2000, 4000, 6000, 8000, 10000 cells;
[0040] (6) Mix the above-mentioned diluted cell lysate with 20 μL probe solution (10 nM), 1.0 μL EXOⅢ shearing enzyme (20 U / μL) and 10 μL dNTPs (10 mM), and dilute to 100 μL with PBS buffer;
[0041] (7) After incubating at 3...
PUM
Property | Measurement | Unit |
---|---|---|
width | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap