Method for increasing wheat yield by creating wheat TaOTUB1 gene function deletion homozygous mutants
A gene function, mutant technology, applied in genetic engineering, plant genetic improvement, chemical instruments and methods, etc., to achieve the effects of good repeatability, increased tiller number, seed size and thousand-grain weight
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0038] First, the wheat genome editing vector PBUE411-sgRNA(otub1) targeting the TaOTUB1 gene was constructed based on the binary vector PBUE411; and the editing vector PBUE411-sgRNA(otub1) was introduced into the Agrobacterium strain EHA105.
[0039] The specific method is: use the online website (http: / / crispr.dbcls.jp / ) to find a suitable sgRNA site in the wheat TaOTUB1 gene sequence (the nucleic acid sequence of the sgRNA site is CCATGTGCACATTATTGCTCTG), and design a band restriction based on the sequence. Forward and reverse complementary primers otub1-F(BsaI) and otub1-R(BsaI) for the cleavage site of the endonuclease BsaI;
[0040] The forward and reverse complementary primers otub1-F (Bsa I) and otub1-R (Bsa I) and the carrier PBUE411 were digested with restriction endonuclease Bsa I, and then the two digested fragments were ligated with T4 ligase, and the sgRNA The 22 nucleotide sequences of the site (i.e. CCATGTGCACATTATTGCTCTG) are inserted into the PBUE411 vector t...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com