Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for increasing wheat yield by creating wheat TaOTUB1 gene function deletion homozygous mutants

A gene function, mutant technology, applied in genetic engineering, plant genetic improvement, chemical instruments and methods, etc., to achieve the effects of good repeatability, increased tiller number, seed size and thousand-grain weight

Active Publication Date: 2021-12-21
NORTHWEST A & F UNIV
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

According to the literature search conducted by the applicant, so far, there is no literature report that Ren Ji used genome editing technology to create a homozygous mutant of wheat TaOTUB1 gene function loss for improving wheat grain yield

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for increasing wheat yield by creating wheat TaOTUB1 gene function deletion homozygous mutants
  • Method for increasing wheat yield by creating wheat TaOTUB1 gene function deletion homozygous mutants
  • Method for increasing wheat yield by creating wheat TaOTUB1 gene function deletion homozygous mutants

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0038] First, the wheat genome editing vector PBUE411-sgRNA(otub1) targeting the TaOTUB1 gene was constructed based on the binary vector PBUE411; and the editing vector PBUE411-sgRNA(otub1) was introduced into the Agrobacterium strain EHA105.

[0039] The specific method is: use the online website (http: / / crispr.dbcls.jp / ) to find a suitable sgRNA site in the wheat TaOTUB1 gene sequence (the nucleic acid sequence of the sgRNA site is CCATGTGCACATTATTGCTCTG), and design a band restriction based on the sequence. Forward and reverse complementary primers otub1-F(BsaI) and otub1-R(BsaI) for the cleavage site of the endonuclease BsaI;

[0040] The forward and reverse complementary primers otub1-F (Bsa I) and otub1-R (Bsa I) and the carrier PBUE411 were digested with restriction endonuclease Bsa I, and then the two digested fragments were ligated with T4 ligase, and the sgRNA The 22 nucleotide sequences of the site (i.e. CCATGTGCACATTATTGCTCTG) are inserted into the PBUE411 vector t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for increasing wheat yield by creating wheat TaOTUB1 gene function deletion homozygous mutants. The method comprises the steps: searching proper sgRNA loci in wheat TaOTUB1 gene sequences, constructing wheat genome editing vectors PBUE411-sgRNA (otub1) and leading the wheat genome editing vectors PBUE411-sgRNA (otub1) into agrobacterium strains EHA105; performing genetic transformation on wheat immature embryo callus by the aid of the agrobacterium strains EHA105 carrying the PBUE411-sgRNA (otub1) vectors; screening three parts of wheat regeneration plants with homologous gene mutation of wheat TaOTUB1 by the aid of detection kits and enzyme digestion; performing generation addition and continuous selfing on the regeneration plants with TaOTUB1 gene mutation in greenhouses, screening TaOTUB1 gene function deletion homozygous mutant plants by the aid of HI-TOM detection kits and enzyme digestion, and identifying and screening plants without the PBUE411-sgRNA(otub1) editing vectors by smearing glufosinate-ammonium on leaves; and acquiring TaOTUB1 gene function deletion homozygous mutant plants otub1 without exogenous vectors. The tiller number and the grain number per spike are remarkably increased, the seed size and the grain weight are remarkably increased, the yield of grains of a single plant is remarkably increased, other characters are not remarkably affected, and the method has the advantages of orientation, rapidness, effectiveness and good repeatability.

Description

technical field [0001] The present invention relates to a method for improving wheat yield by using genome editing technology, and in particular to a method for improving wheat yield by creating a homozygous mutant of wheat TaOTUB1 gene function loss. The method can increase the number of effective tillers and the number of grains per plant of wheat, Increase thousand-grain weight and increase wheat grain yield. Background technique [0002] Wheat is one of the three staple crops in my country and even in the world, providing more than 20% of the calories and protein in the human diet. Increasing wheat yields is critical to global food and nutritional security (FAO, http: / / faostat.fao.org). Wheat yield is composed of the number of ears per mu, the number of grains per ear, and the thousand-grain weight; among them, the grain weight has high heritability and stability, and has great potential for improvement (Brinton and Uauy2019; Li, Xu et al.2019). Among the three compone...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/84C12N15/29A01H5/10A01H6/46
CPCC07K14/415C12N15/8205C12N15/8216C12N15/8261
Inventor 赵惠贤郭利建
Owner NORTHWEST A & F UNIV