Nucleic acid ligand and application thereof

A nucleic acid ligand and nucleic acid technology, applied in chemical treatment to inactivate enzymes, organic chemistry, biochemical equipment and methods, etc., can solve problems such as long cycle, slow process, and complexity, and achieve the purpose of inhibiting non-specific amplification, Reduce the effect of non-specific amplification

Pending Publication Date: 2022-01-07
SUZHOU NUHIGH BIOTECH
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The process of screening aptamers generally includes five basic steps, namely: binding, separation, elution, amplification and regulation, and then the target aptamers are obtained through iterative cycles. The whole screening requires a very long cycle and the process is relatively slow and complicated

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nucleic acid ligand and application thereof
  • Nucleic acid ligand and application thereof
  • Nucleic acid ligand and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0063] Embodiment 1: the assay method of nucleic acid ligand inhibition polymerase enzymatic activity

[0064] Using the single-strand extension method to detect, use the purchased NEB M13 single-stranded DNA and related primers to measure the activity, and use the fluorescence quantitative method to detect in real time. The instrument used in the present invention is Roche LC480II.

[0065] Primer M13R sequence and amplification system are as follows:

[0066] M13R Primer 1ACGCTCGTCATCAAAAATCACTCGCATCAACCAAACCGTTAT

[0067] Table 1

[0068] components concentration Add volume ul per serving 10x Buffer A 10x 2.5 MgCl 2

250mM 0.5 SG 100x 0.4 M13ssDNA 0.73mg / ml 0.45 dNTP 100mM 0.2 M13R 100uM 0.1 taq enzyme / 1 ddH2O / 19.85

[0069] Among them, 10X bufferA is 30mM, Tris 8.0; 50mM KCl; TWEEN20 0.05%; Buffer prepared by 10mM mercaptoethanol. This reaction system has high repeatability and accuracy...

Embodiment 2

[0075] Example 2: Blocking experiment of polymerase (select optimal isothermal extension conditions to screen nucleic acid ligands)

[0076] Extend according to the method of Example 1 at 70°C, 60°C, 50°C, and 40°C to screen which nucleic acid ligands achieve the expected effect, such as the following nucleic acid ligands:

[0077] Nucleic acid ligand 1 (nucleic acid polymerase substrate analogue): TCGAACGGTATATATATTAATATATATAC (shown in SEQ ID NO: 1), 3' end dideoxy modification.

[0078] First mix 6U DNase with the above nucleic acid ligand 1, then add about 6U DNase and mix according to the 100uM 0.05ul system, and test at -20 overnight. At the same time, the system without nucleic acid ligand was used as the control system. According to the method for measuring activity in Example 1, the enzyme activities of the two systems were tested respectively.

[0079] Depend on Figure 4-7It can be seen that in the system without adding nucleic acid ligands, the signal of the pol...

Embodiment 3

[0081] Embodiment 3: the blocking experiment of polymerase

[0082] The 3' end modification of nucleic acid molecules or nucleic acid molecule analogs can be in common ways to prevent amplification (dideoxy modification, phosphorylation modification, amino modification, etc.). In this embodiment, the dideoxy method is selected to terminate terminal extension. At the same time, the nucleic acid molecule without modification at the 3' end was used as a control to test whether the unmodified nucleic acid molecule can also inhibit the enzyme activity. The experimental method refers to Example 1. The sequences of the two nucleic acid ligands are as follows:

[0083] Nucleic acid ligand 1 (nucleic acid polymerase substrate analogue): TCGAACGGTATATATATTAATATATATAC (shown in SEQ ID NO: 1), 3' end dideoxy modification;

[0084] Control nucleic acid ligand (nucleic acid polymerase substrate analog): TCGAACGGTATATATATTAATATATATAC, 3' end unmodified;

[0085] 6U DNA polymerase was mixed...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of biology and particularly discloses a nucleic acid ligand (nucleic acid polymerase substrate analogue) and application thereof. The nucleic acid ligand is a single nucleic acid molecule or a nucleic acid molecule analogue which forms complementary pairing in a molecule, or a single or two nucleic acid molecules or nucleic acid molecule analogues which form complementary pairing among molecules; and a 3' terminal of the nucleic acid ligand has modification for inhibiting extension of the 3' terminal of the nucleic acid ligand. According to the nucleic acid ligand provided by the invention, when an amplification reaction mixture is kept at or below a certain temperature, the enzyme activity of nucleic acid polymerase is inhibited by the nucleic acid ligand, and no residual enzyme activity exists. When the reaction mixture is heated, the nucleic acid polymerase is separated from the nucleic acid ligand, activity is exerted, and a primer extension product is formed, so that the effect of inhibiting non-specific amplifications is achieved. The nucleic acid ligand is applicable to all polymerases and can be widely applied to the field of nucleic acid amplification, so that the non-specific amplifications are reduced.

Description

[0001] This application claims the priority of the Chinese patent application with the application number 202010576818.3 and the invention title "A Nucleic Acid Ligand and Its Application" submitted to the China Patent Office on June 22, 2020, the entire contents of which are incorporated by reference in this application middle. technical field [0002] The present invention relates to the field of biotechnology, more specifically to a nucleic acid ligand (nucleic acid polymerase substrate analog) and its application. Background technique [0003] Polymerase chain reaction (PCR) is a molecular biology technique used to amplify specific DNA fragments. It is a special DNA replication outside the body and can greatly increase a small amount of DNA. PCR consists of three basic reaction steps: denaturation-annealing-extension: ① Denaturation of template DNA: After the template DNA is heated to about 93°C for a certain period of time, the double-stranded DNA of the template or the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/115C12Q1/6848
CPCC12N15/115C12Q1/6848C12N2310/16C12Q2521/101C12Q2525/205C12Q2533/101C12P19/34C12N9/99C12N9/1252C12N9/1247C12N9/1276C12Q2521/119C12Q2525/186C12Q2525/301C12Q2527/101C12Q2549/101C12Q1/6844C12Q1/6876
Inventor毕万里何文龙伏东科潘婕邢亚东王志清秦萍萍
OwnerSUZHOU NUHIGH BIOTECH