Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of human SUN3 gene and related products

A gene and application technology, applied in the application of human SUN3 gene and related products, can solve the problems of no SUN3 gene, failure to assemble, and increased frequency of sperm cell apoptosis, and achieve inhibition of proliferation, inhibition of proliferation, and inhibition of gastric cancer growth Effect

Pending Publication Date: 2022-01-11
SHANGHAI GENECHEM
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The manchette structure of sperm cells in Sun3 knockout mice cannot be assembled, and the frequency of sperm cell apoptosis increases
[0004] There is no relevant report on the use of SUN3 gene in the treatment of gastric cancer

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of human SUN3 gene and related products
  • Application of human SUN3 gene and related products
  • Application of human SUN3 gene and related products

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0092] Example 1 Preparation of RNAi lentivirus against human SUN3 gene

[0093] 1. Screening for effective siRNA targets against the human SUN3 gene

[0094] Retrieve SUN3 (NM_001030019) gene information from Genbank; design effective siRNA targets for SUN3 gene. Table 1-1 lists the screened effective siRNA target sequences against the SUN3 gene.

[0095] Table 1-1 is targeted at the siRNA target sequence of human SUN3 gene

[0096] SEQ ID NO TargetSeq(5'-3') 1 cggcgacttgaacatagtaaa

[0097] 2. Preparation of lentiviral vector

[0098] Aim at the siRNA target (take SEQ ID NO: 1 as an example) to synthesize a double-stranded DNA Oligo sequence (Table 1-2) with Age I and EcoR I restriction sites at both ends; Dicer acts on the pGCSIL-GFP vector (provided by Shanghai Jikai Gene Medical Technology Co., Ltd.) to linearize it, and agarose gel electrophoresis identifies the digested fragments.

[0099] Table 1-2 Double-stranded DNA Oligo with sticky ends c...

Embodiment 2

[0118] Example 2 Real-time fluorescent quantitative RT-PCR method to detect gene silencing efficiency

[0119] Human gastric cancer AGS cells in the logarithmic growth phase were digested with trypsin to make a cell suspension (the number of cells was about 5×10 4 / ml) were inoculated in a 6-well plate and cultured until the cell confluency reached about 30%. According to the multiplicity of infection (MOI, AGS: 10), an appropriate amount of the lentivirus prepared in Example 1 was added, the culture medium was replaced after 24 hours of culture, and the cells were collected after the infection time reached 5 days. Total RNA was extracted according to the instruction manual of Invitrogen's Trizol. According to the M-MLV instruction manual of Promega Company, RNA was reverse-transcribed to obtain cDNA (see Table 2-1 for the reverse transcription reaction system, react at 42°C for 1 hour, and then bathe in a water bath at 70°C for 10 minutes to inactivate the reverse transcript...

Embodiment 3

[0126]Example 3 Detection of proliferation ability of tumor cells infected with SUN3-siRNA lentivirus

[0127] Human gastric cancer AGS cells in the logarithmic growth phase were digested with trypsin to make a cell suspension (the number of cells was about 5×10 4 / ml) were inoculated in a 6-well plate and cultured until the cell confluency reached about 30%. According to the multiplicity of infection (MOI, AGS: 10), an appropriate amount of virus was added, and the culture medium was replaced after 24 hours of culture. After the infection time reached 5 days, the cells of each experimental group in the logarithmic growth phase were collected. The complete medium was resuspended into a cell suspension (2×10 4 / ml), inoculate a 96-well plate at a cell density of about 3000 / well. 5 replicate wells in each group, 100 μl per well. After laying the board, place at 37°C, 5% CO 2 Incubator cultivation. From the second day after plating, the plate was detected and read once a day...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of biological medicine research, and particularly relates to application of a human SUN3 gene serving as a target to preparation of gastric cancer treatment drugs or gastric cancer diagnosis drugs. Through extensive and deep researches, proliferation of gastric cancer cells can be effectively inhibited, cell apoptosis can be promoted and the growth process of gastric cancer can be effectively controlled after the expression of the human SUN3 gene is down-regulated by adopting an RNAi (Ribonucleic Acid Interfere) method. The siRNA or the nucleic acid construct containing the siRNA sequence and the lentivirus provided by the invention can specifically inhibit the proliferation capacity of gastric cancer cells and inhibit the growth of gastric cancer, so that the gastric cancer is treated, and a new direction is opened up for gastric cancer treatment.

Description

technical field [0001] The invention belongs to the field of biomedical research, and specifically relates to the use of human SUN3 gene and related products. Background technique [0002] SUN3 (Sad1 and UNC84 domain containing 3) is a protein-coding gene. Diseases associated with SUN3 include deafness, autosomal recessive inheritance and deafness. An important paralog of this gene is SUN1. [0003] It has been reported that a variety of mice with abnormal head shape sperm are infertile, suggesting that normal head shape is an important prerequisite for normal sperm function. However, the specific molecular mechanism that regulates the correct shape of the sperm cell head is still unclear. A study [The testis-specific LINC component SUN3 is essential for sperm headshaping during mouse spermiogenesis.] prepared Sun3 (Sad-1 / UNC-84domain containing 3) knockout mice by CRISPR / Cas9 technology. After the deletion of Sun3, the sperm morphology of the mice was abnormal and the n...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): G01N33/574C12N15/113C12Q1/6886C12N15/867C12N7/01A61K45/00A61K31/713A61P35/00C12R1/93
CPCG01N33/57446G01N33/57484C12Q1/6886C12N15/113C12N15/86C12N7/00A61K45/00A61K31/713A61P35/00C12Q2600/158C12Q2600/136C12N2310/14C12N2320/30C12N2740/15021C12N2740/15043C12N2800/107G01N2500/04C12N2310/531
Inventor 徐英秀曹跃琼
Owner SHANGHAI GENECHEM
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More