Application of human SUN3 gene and related products
A gene and application technology, applied in the application of human SUN3 gene and related products, can solve the problems of no SUN3 gene, failure to assemble, and increased frequency of sperm cell apoptosis, and achieve inhibition of proliferation, inhibition of proliferation, and inhibition of gastric cancer growth Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0092] Example 1 Preparation of RNAi lentivirus against human SUN3 gene
[0093] 1. Screening for effective siRNA targets against the human SUN3 gene
[0094] Retrieve SUN3 (NM_001030019) gene information from Genbank; design effective siRNA targets for SUN3 gene. Table 1-1 lists the screened effective siRNA target sequences against the SUN3 gene.
[0095] Table 1-1 is targeted at the siRNA target sequence of human SUN3 gene
[0096] SEQ ID NO TargetSeq(5'-3') 1 cggcgacttgaacatagtaaa
[0097] 2. Preparation of lentiviral vector
[0098] Aim at the siRNA target (take SEQ ID NO: 1 as an example) to synthesize a double-stranded DNA Oligo sequence (Table 1-2) with Age I and EcoR I restriction sites at both ends; Dicer acts on the pGCSIL-GFP vector (provided by Shanghai Jikai Gene Medical Technology Co., Ltd.) to linearize it, and agarose gel electrophoresis identifies the digested fragments.
[0099] Table 1-2 Double-stranded DNA Oligo with sticky ends c...
Embodiment 2
[0118] Example 2 Real-time fluorescent quantitative RT-PCR method to detect gene silencing efficiency
[0119] Human gastric cancer AGS cells in the logarithmic growth phase were digested with trypsin to make a cell suspension (the number of cells was about 5×10 4 / ml) were inoculated in a 6-well plate and cultured until the cell confluency reached about 30%. According to the multiplicity of infection (MOI, AGS: 10), an appropriate amount of the lentivirus prepared in Example 1 was added, the culture medium was replaced after 24 hours of culture, and the cells were collected after the infection time reached 5 days. Total RNA was extracted according to the instruction manual of Invitrogen's Trizol. According to the M-MLV instruction manual of Promega Company, RNA was reverse-transcribed to obtain cDNA (see Table 2-1 for the reverse transcription reaction system, react at 42°C for 1 hour, and then bathe in a water bath at 70°C for 10 minutes to inactivate the reverse transcript...
Embodiment 3
[0126]Example 3 Detection of proliferation ability of tumor cells infected with SUN3-siRNA lentivirus
[0127] Human gastric cancer AGS cells in the logarithmic growth phase were digested with trypsin to make a cell suspension (the number of cells was about 5×10 4 / ml) were inoculated in a 6-well plate and cultured until the cell confluency reached about 30%. According to the multiplicity of infection (MOI, AGS: 10), an appropriate amount of virus was added, and the culture medium was replaced after 24 hours of culture. After the infection time reached 5 days, the cells of each experimental group in the logarithmic growth phase were collected. The complete medium was resuspended into a cell suspension (2×10 4 / ml), inoculate a 96-well plate at a cell density of about 3000 / well. 5 replicate wells in each group, 100 μl per well. After laying the board, place at 37°C, 5% CO 2 Incubator cultivation. From the second day after plating, the plate was detected and read once a day...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap