Tobacco nicotine metabolism related gene and application thereof

A nicotine and tobacco technology, applied in application, genetic engineering, plant genetic improvement and other directions, can solve the problems of no cultivation and utilization value, poor agronomic traits and the like

Pending Publication Date: 2022-02-25
CHINA TOBACCO YUNNAN IND
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There are certain low-nicotine materials in tobacco genetic resources, but these

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Tobacco nicotine metabolism related gene and application thereof
  • Tobacco nicotine metabolism related gene and application thereof
  • Tobacco nicotine metabolism related gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] The acquisition of embodiment 1 NtLNP2 gene

[0036] Using the cultivar Tobacco Safflower Dajin Yuangen as the experimental material, the total RNA of tobacco roots was extracted with an RNA extraction kit, and reverse-transcribed into cDNA for future use:

[0037] Tobacco total RNA was extracted according to the instructions of the plant RNA extraction kit.

[0038] 1 μg of total RNA was extracted from leaves for reverse transcription, and the transcription system was as follows:

[0039] Total RNA 1μg;

[0040] Oligo(dT) (10μM) 1.5μL;

[0041] wxya 2 O up to 15 μL;

[0042] Mix the above system and place it in PCR, incubate at 70°C for 5 minutes, immediately place it on ice for 5 minutes after removal, and then add the following reagents to the system:

[0043]

[0044] The above system was placed in a PCR instrument, kept at 42°C for 65 minutes, 65°C for 10 minutes, kept at 4°C, and then stored in a -20°C refrigerator for use.

[0045] Through the method of ...

Embodiment 2

[0053] Construction of embodiment 2 expression vector

[0054] Using the gene NtLNP2 related to nicotine metabolism obtained in Example 1, the present invention further constructed a CRISPR / Cas9 vector.

[0055] (1) Design and synthesis of sgRNA sequence of NtLNP2 gene:

[0056] The online software CRISPR-P 2.0 (http: / / cbi.hzau.edu.cn / crispr / ) was used to design the sgRNA guide sequence, and the guide sequence with a higher score and located at the appropriate position of the NtLNP2 gene sequence was selected. The sgRNA sequence selected in this application is: GAGACCTGCAGATCTACCCGCGG (SEQ ID No.5).

[0057] (2) Design the forward and reverse primers of the sgRNA sequence and submit them to the design company for synthesis: upstream primer sgRNA-F: GATTGGAGACCTGCAGATCTACCCG (SEQ ID No.6) and downstream primer sgRNA-R: AAACCGGGTAGATCTGCAGGTCTCC (SEQ ID No.7);

[0058] (3) Primer annealing: the synthetic target sequence primers (upstream primer and downstream primer) were ster...

Embodiment 3

[0080] Example 3 Transformation of Agrobacterium

[0081] Using the CRISPR / Cas9-NtLNP2 editing vector plasmid constructed in the previous step, taking Honghua Dajinyuan as an example, carry out genetic transformation and tissue culture, and obtain plants in which the gene NtLNP2 related to tobacco nicotine metabolism has been knocked out and edited, and related experimental procedures A brief introduction is as follows.

[0082] Sterilize the surface of tobacco seeds and plant them on MS medium. After they grow to 4 cotyledons (15-20 days), transfer them into culture bottles containing MS solid medium, and place them at 25±1°C under light intensity of 30-50 μmol / ( m2·s), and the light time is 16h / d to continue culturing for 35-40d, and set aside.

[0083] Transform the plasmid with the correct sequence into Agrobacterium, the specific steps are as follows:

[0084] (1) Take out the LBA4404 electroporation-competent Agrobacterium cells stored at -80°C and freeze-thaw them on ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a tobacco nicotine metabolism related gene and application thereof. The gene is an NtLNP2 gene, the sequence of the gene is SEQ ID No.1, and after the sequence of the gene is translated, the coded protein sequence is SEQ ID No.2. A method for knocking out the tobacco nicotine metabolism related gene by using a CRISPR/Cas9 system comprises the following steps: (1) designing an sgRNA guide sequence, and constructing an sgRNA expression vector; (2) introducing the expression vector into agrobacterium; (3) infecting the callus; and (4) carrying out a detection test on the nicotine content of the squaring-stage leaves of the NtLNP2 gene homozygous knockout material by GC-MS. The gene and the method provided by the invention provide genetic materials and theoretical basis for tobacco nicotine metabolism gene function research and low-nicotine tobacco new variety cultivation research.

Description

technical field [0001] The invention relates to the technical field of plant genetic engineering, in particular to a gene related to tobacco nicotine metabolism and its application. Background technique [0002] Alkaloids are important chemical components of Nicotiana plants, among which nicotine is the most important alkaloid, accounting for more than 90%. Nicotine is the main physiologically active component in tobacco leaves, and its content determines the physiological strength of tobacco leaves, and is also the main component of tobacco products' addictiveness. In order to reduce the smoking rate, the World Health Organization recommends that the nicotine content in cigarette shreds be reduced to below 0.4 mg / g. Therefore, the feasibility of low-nicotine content tobacco leaf production technology and its impact on tobacco leaf quality and consumer experience have become research hotspots in the international tobacco industry in recent years. [0003] The nicotine cont...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/29C12N15/84A01H5/12A01H6/82
CPCC07K14/415C12N15/8218C12N15/8243
Inventor 向海英孔维松曾婉俐李雪梅宋春满许力黄昌军张建铎李晶许永孔维玲刘馨笍彤
Owner CHINA TOBACCO YUNNAN IND
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap