Unlock instant, AI-driven research and patent intelligence for your innovation.

Sulfonamide antibiotic degrading bacterium at low temperature and application thereof

A technology for degrading bacteria and sulfonamides, which is applied in the direction of bacteria, microorganisms, and methods based on microorganisms. It can solve the problems of less microbial degradation of sulfadiazine and less degradation of sulfadiazine, and achieve high efficiency.

Active Publication Date: 2022-03-08
SHENYANG INST OF APPLIED ECOLOGY - CHINESE ACAD OF SCI
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] At present, there are few researches on the microbial degradation of sulfadiazine. Some researchers have screened and isolated strains capable of degrading sulfa antibiotics, but most studies only focus on the degradation research at medium and high temperatures. Li Liancheng screened out FF bacteria at 31.5°C The degradation rate of sulfamethoxazole in 240 hours is 22.4%, and the degradation rate of sulfamethazine in NT16 bacteria is 28.6% in 240 hours. There are few studies on the degradation of sulfamethazine under low temperature conditions.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Sulfonamide antibiotic degrading bacterium at low temperature and application thereof
  • Sulfonamide antibiotic degrading bacterium at low temperature and application thereof
  • Sulfonamide antibiotic degrading bacterium at low temperature and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Example 1: Isolation of Acinetobacter sp.

[0034] It is obtained from the soil of a livestock and poultry farm in Shenbei New District, Shenyang City, Liaoning Province through enrichment, separation and purification; specifically, the following steps are included:

[0035] Step 1: Enrichment of strains

[0036] Weigh 5g of soil and add it to 250mL enrichment medium, which contains 20mg / L sulfadiazine, and incubate at 15°C and 160r / min in a shaker in the dark for 7 days. Take 5mL enrichment culture solution and add it to the new enrichment medium to continue culturing according to the above culture conditions, and then transfer again, and increase the concentration of sulfadiazine in the enrichment medium for each transfer by 20 mg / L. Repeat the above steps for transfer culture until the concentration of sulfadiazine in the enrichment medium reaches 100 mg / L.

[0037] Step 2: Isolation and purification of strains

[0038] Dilute the enriched culture solution with st...

Embodiment 2

[0045] Embodiment 2: bacterial strain 16S identification

[0046] (1) Genome extraction

[0047] Using the TIANamp Bacteria DNA Kit Bacterial Genomic DNA Extraction Kit from Tiangen Biochemical Technology Co., Ltd., the genomic DNA of strain H-3 was extracted according to the instructions.

[0048] (2) PCR amplification

[0049] The 16S universal primers are: 27F: AGAGTTTGATCCTGGCTCAG 1492R: TACGGCTACCTTGTTACGACTT, and the PCR length is about 1500bp.

[0050] PCR reaction system:

[0051]

[0052] PCR reaction program:

[0053] Pre-denaturation at 95°C for 4min, deformation at 94°C for 30s, annealing at 55°C for 30s, extension at 72°C for 40s, 35 cycles, extension at 72°C for 7min, and 4°C until termination.

[0054] (3) Gel electrophoresis

[0055] Finally, the obtained PCR product was observed by 1% agarose gel electrophoresis, and the electrophoresis condition was 80V for 30min. The PCR products that were successfully amplified were sent to Huada Gene Technology Co...

Embodiment 3

[0061] Example 3: Verification of the degradation effect of H-3 on sulfadiazine

[0062] H-3 was shaken in LB medium for 24 hours at 37°C and 160rpm, and then inoculated with 5% inoculum into the selection medium containing 20 mg / L sulfadiazine, and cultured at 5°C and 15°C at 160rpm Shake culture in the dark for 20 days, each group set up three parallel, with no bacteria as a blank control. Pass the obtained culture through a 0.22um organic filter membrane, and use high performance liquid chromatography-tandem mass spectrometry to quantitatively detect the residual concentration of sulfadiazine.

[0063] Calculated as follows:

[0064]

[0065] The results showed that the degradation rate of the bacteria could reach 63.5% in 20 days at 15°C and 160rpm, and the degradation rate of the blank control was 36.8%. %.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of biological treatment of antibiotic pollution, and particularly relates to a sulfonamide antibiotic degrading bacterium at low temperature and application thereof. The degrading bacterium is gram-negative Acinetobacter sp. H-3, is preserved in the strain preservation center of Institute of Microbiology of Chinese Academy of Sciences on July 22, 2021, and has the number of CGMCC (China General Microbiological Culture Collection Center) No.22940. The invention also discloses a method for preparing the degrading bacterium. The strain provided by the invention has high sulfadiazine degradation efficiency at low temperature, and provides a scientific basis for degradation of sulfadiazine in soil.

Description

technical field [0001] The invention belongs to the technical field of biological treatment of antibiotic pollution, and in particular relates to a sulfonamide antibiotic-degrading bacterium at low temperature (5°C-15°C) and application thereof. Background technique [0002] Antibiotics are secondary metabolites produced by microorganisms or animal and plant life activities, which have a good effect on the prevention and treatment of diseases. Sulfadiazine is a sulfonamide antibiotic, which belongs to synthetic antibiotics. It has the characteristics of broad-spectrum, stability, and easy use. It is often used as a veterinary antibiotic to prevent and control animal diseases. With the development of animal husbandry and aquaculture, the use of sulfadiazine has greatly increased, causing potential impacts on ecosystems and human health, and has become a new type of environmental pollutant. [0003] The extensive use of antibiotics cannot be completely absorbed by livestock a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/20A62D3/02A62D101/28C12R1/01
CPCC12N1/20A62D3/02A62D2101/28
Inventor 张颖张艺赵爽韩斯琴史荣久
Owner SHENYANG INST OF APPLIED ECOLOGY - CHINESE ACAD OF SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More