Sulfonamide antibiotic degrading bacterium at low temperature and application thereof
A technology for degrading bacteria and sulfonamides, which is applied in the direction of bacteria, microorganisms, and methods based on microorganisms. It can solve the problems of less microbial degradation of sulfadiazine and less degradation of sulfadiazine, and achieve high efficiency.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0033] Example 1: Isolation of Acinetobacter sp.
[0034] It is obtained from the soil of a livestock and poultry farm in Shenbei New District, Shenyang City, Liaoning Province through enrichment, separation and purification; specifically, the following steps are included:
[0035] Step 1: Enrichment of strains
[0036] Weigh 5g of soil and add it to 250mL enrichment medium, which contains 20mg / L sulfadiazine, and incubate at 15°C and 160r / min in a shaker in the dark for 7 days. Take 5mL enrichment culture solution and add it to the new enrichment medium to continue culturing according to the above culture conditions, and then transfer again, and increase the concentration of sulfadiazine in the enrichment medium for each transfer by 20 mg / L. Repeat the above steps for transfer culture until the concentration of sulfadiazine in the enrichment medium reaches 100 mg / L.
[0037] Step 2: Isolation and purification of strains
[0038] Dilute the enriched culture solution with st...
Embodiment 2
[0045] Embodiment 2: bacterial strain 16S identification
[0046] (1) Genome extraction
[0047] Using the TIANamp Bacteria DNA Kit Bacterial Genomic DNA Extraction Kit from Tiangen Biochemical Technology Co., Ltd., the genomic DNA of strain H-3 was extracted according to the instructions.
[0048] (2) PCR amplification
[0049] The 16S universal primers are: 27F: AGAGTTTGATCCTGGCTCAG 1492R: TACGGCTACCTTGTTACGACTT, and the PCR length is about 1500bp.
[0050] PCR reaction system:
[0051]
[0052] PCR reaction program:
[0053] Pre-denaturation at 95°C for 4min, deformation at 94°C for 30s, annealing at 55°C for 30s, extension at 72°C for 40s, 35 cycles, extension at 72°C for 7min, and 4°C until termination.
[0054] (3) Gel electrophoresis
[0055] Finally, the obtained PCR product was observed by 1% agarose gel electrophoresis, and the electrophoresis condition was 80V for 30min. The PCR products that were successfully amplified were sent to Huada Gene Technology Co...
Embodiment 3
[0061] Example 3: Verification of the degradation effect of H-3 on sulfadiazine
[0062] H-3 was shaken in LB medium for 24 hours at 37°C and 160rpm, and then inoculated with 5% inoculum into the selection medium containing 20 mg / L sulfadiazine, and cultured at 5°C and 15°C at 160rpm Shake culture in the dark for 20 days, each group set up three parallel, with no bacteria as a blank control. Pass the obtained culture through a 0.22um organic filter membrane, and use high performance liquid chromatography-tandem mass spectrometry to quantitatively detect the residual concentration of sulfadiazine.
[0063] Calculated as follows:
[0064]
[0065] The results showed that the degradation rate of the bacteria could reach 63.5% in 20 days at 15°C and 160rpm, and the degradation rate of the blank control was 36.8%. %.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



