Fluorescent quantitative PCR (Polymerase Chain Reaction) detection kit for poria cocos and identification method
A detection kit and fluorescence quantitative technology, which are applied in the determination/inspection of microorganisms, biochemical equipment and methods, DNA/RNA fragments, etc., can solve threats to health, hinder the healthy development of Poria cocos industry, and affect the effectiveness of clinical medication, etc. question
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 2
[0045] Example two Poria cocos counterfeit medicinal materials are identified
[0046] 1. Materials
[0047] The standard and reference substances were purchased from the China National Institutes for Food and Drug Control and the National Standard Substance Resource Platform. 5 batches of standard Poria cocos, Polyporus, Pueraria lobata, Trichosanthes Fen, Chinese yam (batch numbers: 121117~201910, ycwkq20111201, 121551~201805, 121361~202004, 121137~201807)
[0048] 2. Method
[0049] 2.1 Genomic DNA extraction of test samples The modified CTAB method was used to extract the genomic DNA of the samples.
[0050] 2.2PCR primer design and synthesis
[0051] (1) Design a pair of Poria cocos-specific oligonucleotide primers, the following primers
[0052] Primer (Poria cocos, amplification length 101bp)
[0053] Forward primer: 5′GCACCGTCTACAAGCCATCTTCC3′
[0054] Reverse primer: 5′CCTCCCCCACGCCCCAATAAATG 3′
[0055] (2) Artificially synthesize ribosomal in vivo transcripti...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


