Supercharge Your Innovation With Domain-Expert AI Agents!

Primer and kit for detecting salmonella and use method of primer and kit

A technology for Salmonella and Salmonella enteritis, which is applied in the field of kits, can solve the problems of low accuracy, low detection sensitivity, and high cost, achieve high detection accuracy and sensitivity, and avoid the effects of false positives and false negatives in diagnosis

Pending Publication Date: 2022-03-18
CHANGCHUN INST OF APPLIED CHEMISTRY - CHINESE ACAD OF SCI
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] In view of this, the present invention provides a primer for detecting Salmonella in order to solve the problems of low detection sensitivity, low accuracy, prone to false negative and false positive results, and high cost in the detection method of Salmonella in the prior art, Kits and methods of use

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer and kit for detecting salmonella and use method of primer and kit
  • Primer and kit for detecting salmonella and use method of primer and kit
  • Primer and kit for detecting salmonella and use method of primer and kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0099]Design and validation of LAMP primers for the detection of the conserved gene invA in Salmonella spp. SCON-F3, SCON-B3, SCON-FIP, SCON-BIP and SCON-LP according to the molar ratio of 1:1:4:4:2; wherein, the sequence of SCON-F3 is CGTCATTCCATTACCTACCT; the sequence of SCON-B3 The sequence is CAATCAAGATAAGACGACTGG; the sequence of SCON-FIP is GAACGACCCCATAAACACCAATTGGTTGATTTCCTGATCGC; the sequence of SCON-BIP is TGACAGAATCCCTCAGTTTTTCAACGACTGATCGATAATGCCAGAC; the sequence of SCON-LP is ATCGCCAGTACGATATTCAGT.

[0100] Amplify the invA sequence of the conserved gene of Salmonella based on the LAMP method: 25 μL LAMP reaction system contains 1 μL of the analyte, 1.5 μL of 5 μmol / L SCON-B3, 1.5 μL of 5 μmol / L SCON-F3, and 1.5 μL of 20 μmol / L SCON-FIP, 1.5 μL of 20 μmol / L SCON-BIP, 1.5 μL of 10 μmol / L SCON-LP, 1.5 μL of 10 mmol / L dNTPs, 0.5 μL of 100 mmol / L Mg 2+ , 2.5 μL of 10× isothermal amplification buffer (0.2M Tris, 0.1M (NH 4 ) 2 SO 4 , 0.5MKCL, 0.02M MgSO 4 , 0.4g ...

Embodiment 2

[0104] Design and validation of LAMP primers for detecting the serotype-specific expression gene prot6E of Salmonella enterica enterica. E6E-F3, E6E-B3, E6E-FIP, E6E-BIP, and E6E-LP according to the molar ratio of 1:1:4:4:2; wherein, the sequence of E6E-F3 is AGCAATGGTTGGGTTCGG; E6E-B3 The sequence is GCCCTGTACACTGCATCC; the sequence of E6E-FIP is GCACCCTTGCATCTACAGCAGGCAGGGGCACAATAACCGTAA; the sequence of E6E-BIP is TAGCTCGACCAAAGTGACGGTGTCACAACATTCCATGAGCCA; the sequence of E6E-LP is ACCGATGAGCGCCTCTCCGG.

[0105] Amplify the prot6E sequence of Salmonella enterica serotype-specific expression gene based on the LAMP method: 25 μL LAMP reaction system contains 1 μL of the analyte, 1.5 μL of 5 μmol / L E6E-B3, 1.5 μL of 5 μmol / L E6E-F3, 1.5 μL 20 μmol / L E6E-FIP, 1.5 μL 20 μmol / L LE6E-BIP, 1.5 μL 10 μmol / L E6E-LP, 1.5 μL 10 mmol / L dNTPs, 0.5 μL 100 mmol / L Mg 2+ , 2.5 μL of 10× isothermal amplification buffer, 5 μL of 5mol / L betaine, 1 μL of 20× Evagreen dye and 1.5 μL of 8U Bst 2...

Embodiment 3

[0109] Design and verification of LAMP primers for detection of Salmonella typhimurium-specific expression gene mdh. According to the TMDH-F3, TMDH-B3, TMDH-FIP, TMDH-BIP and TMDH-LP of 1:1:4:4:2 according to the molar ratio of substances; wherein, the sequence of TMDH-F3 is CGCTGGATATCATCCGCTC; TMDH-B3 The sequence is TTCGCCTCGACGACTTCA; the sequence of TMDH-FIP is GAATCGTCACGCCGGAGTGCGCTGAAAGGTAAGCTGCCA; the sequence of TMDH-BIP is GCTGTCGCAGATTCCAGGCGACCGGCGTTCTGAATACGT; the sequence of TMDH-LP is CCGCCAATCACCGGCACTTCAACTTCCGT.

[0110] Amplify the mdh sequence of Salmonella typhimurium-specific expression gene based on the LAMP method: 25 μL LAMP reaction system contains 1 μL of the analyte, 1.5 μL of 5 μmol / L TMDH-B3, 1.5 μL of 5 μmol / L TMDH-F3, and 1.5 μL of 20 μmol / LTMDH-FIP, 1.5 μL of 20 μmol / L TMDH-BIP, 1.5 μL of 10 μmol / L TMDH-LP, 1.5 μL of 10 mmol / L dNTPs, 0.5 μL of 100 mmol / L Mg 2+ , 2.5 μL of 10× isothermal amplification buffer, 5 μL of 5mol / L betaine, 1 μL of 2...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer and a kit for detecting salmonella and a use method of the kit, and belongs to the field of bacterial detection. The problems that a salmonella detection method in the prior art is low in detection sensitivity, low in accuracy and high in cost, and false negative and false positive results are likely to occur are solved. The kit disclosed by the invention comprises LAMP (loop-mediated isothermal amplification) primers of a salmonella conserved gene invA, an enteritis serotype specific expression gene prot6E of salmonella enterica, a specific expression gene mdh of salmonella typhimurium, a probe SC-E6 and a probe SC-E6-TM. The kit for detecting salmonella has very high detection accuracy and sensitivity, is convenient to operate and low in cost, and can avoid aerosol pollution in the detection process.

Description

technical field [0001] The invention belongs to the technical field of kits, and in particular relates to a primer for detecting Salmonella, a kit and a use method thereof. Background technique [0002] Salmonella, as a food-borne pathogen, can pollute meat, eggs, milk and other foods, posing a great threat to the health of humans and animals. Currently, Salmonella infection has been recognized as a major public health problem worldwide. Therefore, the detection and accurate typing of Salmonella is a very important challenge in food safety and standard microbiological analysis. [0003] Existing methods for detecting Salmonella mainly include selective culture medium observation method, immune-based detection method and nucleic acid-based detection method. The culture observation method generally takes 3-4 days to complete, and is prone to false positive or false negative results; the detection method based on immunity is mainly enzyme-linked immunosorbent assay (ELISA), w...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/689C12Q1/6844C12N15/11C12R1/42
CPCC12Q1/689C12Q1/6844C12Q2531/119C12Q2563/107
Inventor 杜衍张偲偲孙祎张晓军杨媚婷
Owner CHANGCHUN INST OF APPLIED CHEMISTRY - CHINESE ACAD OF SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More