Primer and kit for detecting salmonella and use method of primer and kit
A technology for Salmonella and Salmonella enteritis, which is applied in the field of kits, can solve the problems of low accuracy, low detection sensitivity, and high cost, achieve high detection accuracy and sensitivity, and avoid the effects of false positives and false negatives in diagnosis
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0099]Design and validation of LAMP primers for the detection of the conserved gene invA in Salmonella spp. SCON-F3, SCON-B3, SCON-FIP, SCON-BIP and SCON-LP according to the molar ratio of 1:1:4:4:2; wherein, the sequence of SCON-F3 is CGTCATTCCATTACCTACCT; the sequence of SCON-B3 The sequence is CAATCAAGATAAGACGACTGG; the sequence of SCON-FIP is GAACGACCCCATAAACACCAATTGGTTGATTTCCTGATCGC; the sequence of SCON-BIP is TGACAGAATCCCTCAGTTTTTCAACGACTGATCGATAATGCCAGAC; the sequence of SCON-LP is ATCGCCAGTACGATATTCAGT.
[0100] Amplify the invA sequence of the conserved gene of Salmonella based on the LAMP method: 25 μL LAMP reaction system contains 1 μL of the analyte, 1.5 μL of 5 μmol / L SCON-B3, 1.5 μL of 5 μmol / L SCON-F3, and 1.5 μL of 20 μmol / L SCON-FIP, 1.5 μL of 20 μmol / L SCON-BIP, 1.5 μL of 10 μmol / L SCON-LP, 1.5 μL of 10 mmol / L dNTPs, 0.5 μL of 100 mmol / L Mg 2+ , 2.5 μL of 10× isothermal amplification buffer (0.2M Tris, 0.1M (NH 4 ) 2 SO 4 , 0.5MKCL, 0.02M MgSO 4 , 0.4g ...
Embodiment 2
[0104] Design and validation of LAMP primers for detecting the serotype-specific expression gene prot6E of Salmonella enterica enterica. E6E-F3, E6E-B3, E6E-FIP, E6E-BIP, and E6E-LP according to the molar ratio of 1:1:4:4:2; wherein, the sequence of E6E-F3 is AGCAATGGTTGGGTTCGG; E6E-B3 The sequence is GCCCTGTACACTGCATCC; the sequence of E6E-FIP is GCACCCTTGCATCTACAGCAGGCAGGGGCACAATAACCGTAA; the sequence of E6E-BIP is TAGCTCGACCAAAGTGACGGTGTCACAACATTCCATGAGCCA; the sequence of E6E-LP is ACCGATGAGCGCCTCTCCGG.
[0105] Amplify the prot6E sequence of Salmonella enterica serotype-specific expression gene based on the LAMP method: 25 μL LAMP reaction system contains 1 μL of the analyte, 1.5 μL of 5 μmol / L E6E-B3, 1.5 μL of 5 μmol / L E6E-F3, 1.5 μL 20 μmol / L E6E-FIP, 1.5 μL 20 μmol / L LE6E-BIP, 1.5 μL 10 μmol / L E6E-LP, 1.5 μL 10 mmol / L dNTPs, 0.5 μL 100 mmol / L Mg 2+ , 2.5 μL of 10× isothermal amplification buffer, 5 μL of 5mol / L betaine, 1 μL of 20× Evagreen dye and 1.5 μL of 8U Bst 2...
Embodiment 3
[0109] Design and verification of LAMP primers for detection of Salmonella typhimurium-specific expression gene mdh. According to the TMDH-F3, TMDH-B3, TMDH-FIP, TMDH-BIP and TMDH-LP of 1:1:4:4:2 according to the molar ratio of substances; wherein, the sequence of TMDH-F3 is CGCTGGATATCATCCGCTC; TMDH-B3 The sequence is TTCGCCTCGACGACTTCA; the sequence of TMDH-FIP is GAATCGTCACGCCGGAGTGCGCTGAAAGGTAAGCTGCCA; the sequence of TMDH-BIP is GCTGTCGCAGATTCCAGGCGACCGGCGTTCTGAATACGT; the sequence of TMDH-LP is CCGCCAATCACCGGCACTTCAACTTCCGT.
[0110] Amplify the mdh sequence of Salmonella typhimurium-specific expression gene based on the LAMP method: 25 μL LAMP reaction system contains 1 μL of the analyte, 1.5 μL of 5 μmol / L TMDH-B3, 1.5 μL of 5 μmol / L TMDH-F3, and 1.5 μL of 20 μmol / LTMDH-FIP, 1.5 μL of 20 μmol / L TMDH-BIP, 1.5 μL of 10 μmol / L TMDH-LP, 1.5 μL of 10 mmol / L dNTPs, 0.5 μL of 100 mmol / L Mg 2+ , 2.5 μL of 10× isothermal amplification buffer, 5 μL of 5mol / L betaine, 1 μL of 2...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



