Application of Msn2p as negative regulatory factor in improvement of protein expression in host cells
A negative regulator, host cell technology, applied in the fields of molecular biology and bioengineering
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0021] Example 1: Construction of Kan gene replacement transcription repressor Msn2 gene knockout expression cassette
[0022] 1. Amplification of the upstream homology arm
[0023] The present invention takes the genome sequence of Pichia pastoris as a reference, uses software DNAMAN 8 to design and synthesize two oligonucleotide primers, and amplifies the upstream homology arm sequence of Msn2 gene (sequence is SEQ ID NO: 1) by PCR method.
[0024] The two PCR primers are as follows:
[0025] 1-F:ACTTAC GAGCTC GGCTCAGTGGCTTTCCATCTGTT (SEQ ID NO: 4)
[0026] 1-R: CTTACGC GGATCC GCGTCTAGTTAATCGCAAAC (SEQ ID NO: 5)
[0027] The underlined bases are SacI and BamHI restriction endonuclease sites, respectively.
[0028] The PCR reaction system is shown in Table 1 below.
[0029] Table 1:
[0030] component Volume (μL) 2×Q5 Master Mix 12.5 Primer F (10μM) 1.25 Primer R (10μM) 1.25 template DNA 1(100ng) ddH 2 O
9ul total c...
Embodiment 2
[0067] Example 2: Construction of expression cassette for complete knockout of transcription repressor Msn2 gene
[0068] As in the method in Example 1, primers 1-F, 1-R and 2-F, 2-R were used to amplify the upper and lower homology arms of Msn2 gene, and the upper and lower homology arm fragments were ligated by the above enzyme cleavage. Methods The ppic3.5k vector was linked to construct ppic3.5k-(upstream homology arm)-(downstream homology arm) knockout expression cassette.
Embodiment 3
[0069] Example 3: Genome Msn2 Knockout of Pichia pastoris
[0070] In order to improve the integration efficiency of the single-copy expression cassette on the chromosome of Pichia pastoris, the knockout expression cassette was linearized with restriction endonucleases Sad and NotI and purified and recovered with the kit. The recipient bacteria in this experiment is Pichia pastoris SMD1168 (recombinant bacteria with xylanase xynB gene inserted after Pgap, EX6), the G418 plate containing 0.3 mg / mL was used after electrotransformation of the knockout expression cassette in Example 1 Screening was performed and genomic PCR identification was performed. Example 2 After electrotransformation of the knockout expression cassette, YPG plate was used for screening, and genomic PCR identification was carried out.
[0071] The results of PCR product sequencing showed that the screened strains were positive clones that successfully knocked out Msn2.
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap