Application of Msn2p as negative regulatory factor in improvement of protein expression in host cells

A negative regulator, host cell technology, applied in the fields of molecular biology and bioengineering

A negative regulator, host cell technology, applied in the fields of molecular biology and bioengineering

CN114657190AActive Publication Date: 2022-06-24JINAN UNIVERSITY

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of Msn2p as negative regulatory factor in improvement of protein expression in host cells
  • Application of Msn2p as negative regulatory factor in improvement of protein expression in host cells
  • Application of Msn2p as negative regulatory factor in improvement of protein expression in host cells

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] Example 1: Construction of Kan gene replacement transcription repressor Msn2 gene knockout expression cassette

[0022] 1. Amplification of the upstream homology arm

[0023] The present invention takes the genome sequence of Pichia pastoris as a reference, uses software DNAMAN 8 to design and synthesize two oligonucleotide primers, and amplifies the upstream homology arm sequence of Msn2 gene (sequence is SEQ ID NO: 1) by PCR method.

[0024] The two PCR primers are as follows:

[0025] 1-F:ACTTAC GAGCTC GGCTCAGTGGCTTTCCATCTGTT (SEQ ID NO: 4)

[0026] 1-R: CTTACGC GGATCC GCGTCTAGTTAATCGCAAAC (SEQ ID NO: 5)

[0027] The underlined bases are SacI and BamHI restriction endonuclease sites, respectively.

[0028] The PCR reaction system is shown in Table 1 below.

[0029] Table 1:

[0030] component Volume (μL) 2×Q5 Master Mix 12.5 Primer F (10μM) 1.25 Primer R (10μM) 1.25 template DNA 1(100ng) ddH 2 O

9ul total c...

Embodiment 2

[0067] Example 2: Construction of expression cassette for complete knockout of transcription repressor Msn2 gene

[0068] As in the method in Example 1, primers 1-F, 1-R and 2-F, 2-R were used to amplify the upper and lower homology arms of Msn2 gene, and the upper and lower homology arm fragments were ligated by the above enzyme cleavage. Methods The ppic3.5k vector was linked to construct ppic3.5k-(upstream homology arm)-(downstream homology arm) knockout expression cassette.

Embodiment 3

[0069] Example 3: Genome Msn2 Knockout of Pichia pastoris

[0070] In order to improve the integration efficiency of the single-copy expression cassette on the chromosome of Pichia pastoris, the knockout expression cassette was linearized with restriction endonucleases Sad and NotI and purified and recovered with the kit. The recipient bacteria in this experiment is Pichia pastoris SMD1168 (recombinant bacteria with xylanase xynB gene inserted after Pgap, EX6), the G418 plate containing 0.3 mg / mL was used after electrotransformation of the knockout expression cassette in Example 1 Screening was performed and genomic PCR identification was performed. Example 2 After electrotransformation of the knockout expression cassette, YPG plate was used for screening, and genomic PCR identification was carried out.

[0071] The results of PCR product sequencing showed that the screened strains were positive clones that successfully knocked out Msn2.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an application of a transcriptional regulatory factor expressed by eukaryotic genes, in particular to an application of a transcriptional regulatory factor Msn2p of a constitutive promoter Pgap. The invention discloses application of Msn2p as a negative regulatory factor in improving protein expression in host cells. The amino acid sequence of the Msn2p is coded by an Msn2 gene with the nucleotide sequence of SEQ ID NO: 1; according to the application, expression of protein in host cells is improved by knocking out the Msn2 gene. According to the application disclosed by the invention, transcriptional regulation and control of the constitutive promoter Pgap in a pichia pastoris expression system can be enhanced by reducing a repression effect, so that the expression efficiency and the yield of target protein are improved.

Description

technical field [0001] The invention belongs to the fields of molecular biology and bioengineering, and relates to the application of a transcriptional regulator of eukaryotic gene expression, in particular to the application of a transcriptional regulator Msn2p of a constitutive promoter Pgap. Background technique [0002] The promoter is one of the most important elements in regulating gene expression, P AOX1 Promoter (inducible) and Pgap promoter (constitutive) are the most representative promoters for exogenous protein expression in Pichia pastoris. [0003] Methanol-inducible Pichia expression system is currently a commonly used expression system for expressing most heterologous proteins. However, not all exogenous proteins are suitable for methanol-inducible expression and methanol has great safety hazards in large-scale production. Compared with methanol induction, the constitutive Pichia pastoris expression system does not use methanol induction when expressing hete...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
24 Jun 2022
Publication
CN114657190A
IPC
C12N15/31; C12N15/81; C12N1/19; C12R1/84; C12R1/865; C12R1/72
CPC
C07K14/395; C07K14/39; C07K14/40; C12N15/815; Y02A50/30
Inventors
姚冬生; 林香娜