Application of Ash1p as negative regulatory factor in improvement of protein expression in host cells

A technology of negative regulators and host cells, applied in the fields of molecular biology and bioengineering, can solve problems such as the unreported function of Ash1p transcriptional regulation, and achieve the effect of improving expression intensity and high-efficiency expression

Pending Publication Date: 2022-07-22
JINAN UNIVERSITY
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] According to literature reports, when Ash1p is located in the nucleus in Saccharomyces cerevisiae, it can turn off the transcription of HO gene and affect the conversion of Saccharomyces cerevisiae mating type. Through comparison, the Ash1 gene in Pichia pastoris is presumed to be PAS_chr1-1_0414 (serial number: NC_012963.1), but there is no report on the function of Ash1p for transcriptional regulation

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of Ash1p as negative regulatory factor in improvement of protein expression in host cells
  • Application of Ash1p as negative regulatory factor in improvement of protein expression in host cells
  • Application of Ash1p as negative regulatory factor in improvement of protein expression in host cells

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] Example 1: Construction of Kan gene replacement transcription inhibitor Ash1 gene knockout expression cassette 1. Amplification of upstream homology arms

[0022] The present invention takes the genome sequence of Pichia pastoris as a reference, uses software DNAMAN 8 to design and synthesize two oligonucleotide primers, and amplifies the upstream homology arm sequence of Ash1 (SEQ ID NO: 1) by PCR method.

[0023] The two PCR primers are as follows:

[0024] 1-F: ACTTAC GAGCTC GACAGGCAAATCATTCA (SEQ ID NO: 4)

[0025] 1-R: ACTTACGC GGATCC GCGCGTATTTAGCTACAATC (SEQ ID NO: 5)

[0026] The underlined bases are SacI and BamHI restriction endonuclease sites, respectively.

[0027] The PCR reaction system is shown in Table 1 below.

[0028] Table 1:

[0029] component Volume (μL) 2×Q5 Master Mix 12.5 Primer F (10μM) 1.25 Primer R (10μM) 1.25 template DNA 1(100ng) ddH 2 O

9ul total capacity 25ul

[0030] The PC...

Embodiment 2

[0066] Example 2: Construction of expression cassette for complete knockout of transcription repressor Ash1 gene

[0067] As in the method in Example 1, primers 1-F, 1-R and 2-F, 2-R were used to amplify the upper and lower homology arms of the Ash1 gene, and the upstream and downstream homology arm fragments were ligated by the above enzyme cleavage. Methods The ppic3.5k vector was linked to construct ppic3.5k-(upstream homology arm)-(downstream homology arm) knockout expression cassette.

Embodiment 3

[0068] Example 3: Pichia genome Ash1 knockout

[0069] In order to improve the integration efficiency of the single-copy expression cassette on the chromosome of Pichia pastoris, the knockout expression cassette was linearized with restriction endonucleases Sad and NotI and purified and recovered with the kit. The recipient bacteria in this experiment is Pichia pastoris SMD1168 (recombinant bacteria with xylanase xynB gene inserted after Pgap, EX6), the G418 plate containing 0.3 mg / mL was used after electrotransformation of the knockout expression cassette in Example 1 Screening was performed and genomic PCR identification was performed. Example 2 After electrotransformation of the knockout expression cassette, YPG plate was used for screening, and genomic PCR identification was carried out.

[0070] The results of PCR product sequencing showed that the screened strains were positive clones that successfully knocked out Ash1.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to application of a transcriptional regulatory factor expressed by eukaryotic genes, in particular to application of a transcriptional regulatory factor Ash1p of a constitutive promoter Pgap. The invention discloses application of Ash1p as a negative regulatory factor in improvement of protein expression in host cells. The amino acid sequence of the Ash1p is coded by an Ash1 gene with the nucleotide sequence of SEQ ID NO: 1; according to the application, expression of protein in host cells is improved by knocking out the Ash1 gene. According to the application disclosed by the invention, transcriptional regulation and control of the constitutive promoter Pgap in a pichia pastoris expression system can be enhanced by reducing a repression effect, so that the expression efficiency and the yield of target protein are improved.

Description

technical field [0001] The invention belongs to the fields of molecular biology and bioengineering, and relates to the application of a transcriptional regulator of eukaryotic gene expression, in particular to the application of a transcriptional regulator of constitutive promoter Pgap, Ash1p. Background technique [0002] The promoter is one of the most important elements in regulating gene expression, P AOX1 Promoter (inducible) and Pgap promoter (constitutive) are the most representative promoters for exogenous protein expression in Pichia pastoris. [0003] Methanol-inducible Pichia expression system is currently a commonly used expression system for expressing most heterologous proteins. However, not all exogenous proteins are suitable for methanol-inducible expression and methanol has great safety hazards in large-scale production. Compared with methanol induction, the constitutive Pichia pastoris expression system does not use methanol induction when expressing heter...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/81C07K14/395C12N15/31C12N15/113C12N1/19C12R1/84
CPCC12N15/81C07K14/395C12N2800/60
Inventor姚冬生林香娜刘大岭谢春芳丁伟秋
OwnerJINAN UNIVERSITY