Antibodies to CCR5
Antibody, chemokine receptor technology for use in the treatment of disorders and/or conditions, treatment, identification of antagonists of G protein chemokine receptor activity, polynucleotides of novel human polypeptides, prevention and/or diagnosis These diseases, G protein chemokine receptor peptide field, can solve the problems of adverse side effects, patients' difficulty in complying with drug therapy, and undetectable HIV RNA
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 60
[0544] The invention also includes antibodies (including molecules comprising or consisting of antibody fragments or variants thereof) that share one or more of the same biological characteristics as one or more of the antibodies described herein. The so-called "biological characteristics" refer to the in vitro or in vivo activity or properties of the antibody, such as binding to G-protein chemokine receptor (CCR5) (such as G-protein chemokine receptor (CCR5) expressed on the cell surface, membrane chimeric G-protein Chemokine Receptor (CCR5), and / or a fragment or variant of G-protein Chemokine Receptor (CCR5); substantially inhibit or destroy G-protein Chemokine Receptor (CCR5) and G-protein Chemokine Receptor (CCR5) Ability to bind protein chemokine receptor (CCR5) ligands (e.g. MIP1-β, see eg Example 61); ability to downregulate expression of G protein chemokine receptor (CCR5) polypeptides on the cell surface; inhibit or destroy G Protein Chemokine Receptor (CCR5)-mediated...
Embodiment 57
[1123] Other activities
[1124] The polypeptides, polynucleotides, agonists or antagonists of the present invention, as a result of their ability to stimulate the growth of vascular endothelial cells, can be used to treat ischemic tissue damage due to various disease conditions such as thrombosis, arteriosclerosis and other cardiovascular conditions. revascularization. Polypeptides, polynucleotides, agonists or antagonists of the invention can also be used to stimulate angiogenesis and limb regeneration, as discussed previously.
[1125] Polypeptides, polynucleotides, agonists or antagonists of the present invention can also be used to treat, prevent and / or diagnose wounds caused by trauma, burns, post-operative tissue recovery and ulcers, etc., because they promote various sources of cells (such as , fibroblasts, skeletal muscle cells), thus promoting the repair or replacement of damaged or diseased tissue.
[1126] Polypeptides, polynucleotides, agonists or antagonists of...
Embodiment 1
[1138] Bacterial expression and purification of HDGNR10
[1139] Amplification of HDGNR10 encoding ATCC number 97183 was initiated using PCR oligonucleotide primers corresponding to the vector sequence and the 5' sequence of the processed HDGNR10 protein (with signal peptide sequence removed), and the vector sequence located at the 3' end of the HDGNR10 gene DNA sequence. Additional nucleotides corresponding to HDGNR10 were added to the 5' and 3' sequences, respectively. The 5' oligonucleotide primer sequence is: 5'CGGAATTCCTCCATGGATTATCAAGTGTCA 3' (SEQ ID NO: 3), which contains an EcoR I restriction enzyme site, followed by the HDGNR10 coding sequence of 18 nucleotides, the start The predicted terminal amino acid of the codon in the processed protein. The 3' sequence is 5'CGGAAGCTTCGTCACAAAGCCCAGATAT 3' (SEQ ID NO. 4), which contains the sequence complementary to the HindIII site, followed by the 18 nucleotide coding sequence of HDGNR10. The restriction enzyme sites corres...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More