Truncated soluble tumor necrosis factor type-I and type-II receptors
A tumor necrosis, truncation technology, applied in the field of inflammation, which can solve the problem of not taught TNF inhibitors and so on
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example Construction
[0280] Preparation of polynucleotides
[0281] Nucleic acid sequences encoding truncated sTNFRs are readily obtained by various methods including, but not limited to, chemical synthesis, cDNA or genomic library screening, expression library screening and / or PCR amplification of cDNA. These and other methods for isolating this nucleic acid sequence are published in Sambrook et al. Molecular Cloning: A laboratory Manual, Cold Spring Harbor, New York (1989); Ausubel et al. eds. Current Protocols in Molecular Biology, Current Protocols Press, (1994); Berger and Kimmel, Methods in Enzymology: Guide to Molecular Cloning Teehniques, Vol. 152, Academic Perss, Inc., San Diego, CA, (1987), the contents of which are incorporated herein by reference.
[0282] Chemical synthesis of nucleic acid sequences encoding truncated sTNFRs can be accomplished by methods well known in the art. Such as those published by Engels et al., Engels et al. (1989), Angew Chem. Intl. Ed., 28:716-734 and Wells...
Embodiment I
[0384] The following example describes the production of various forms of truncated soluble recombinant TNFR-I. These forms include: NH 2 -MDSVCPQGKYIHPQNNSIC-[Cys 19 -Cys 103 ]-FC-COOH (sTNFR-I 2.6D / C105); NH 2 -MDSVCPQGKYIHPQNNSIC-[Cys 19 -Cys 103 ]-FNCSL-COOH (sTNFR-I 2.6D / C106); NH 2 -MDSVCPQGKYIHPQNNSIC-[Cys 19 -Cys 103 ]-FN-COOH (sTNFR-I 2.6D / N105); NH 2 -MYIHPQNNSIC-[Cys 19 -Cys 103 ]-FNCSL-COOH(sTNFR-I2.3D / d8); NH 2 -M-[Cys 19 -Cys 103 ]-FNCSL-COOH (sTNFR-I 2.3D / d18) and NH 2 -MSIS-[Cys 19 -Cys 103 ]-FNCSL-COOH (sTNFR-I 2.3D / d15). A. Preparation of DNA: 1. sTNFR-I 2.6D / C106
[0385] Using the cDNA cloned on λ-gt 107 ctnfbp (EP 422339) as a template and the following oligonucleotides as primers, sTNFR-I 2.6D / C106 was amplified by PCR. 5' OLIGO #1: (SEQ ID NO: 68)
[0386] 5'GGTTAGCCATATGGACAGCGTTTGCCCCC AA-3' 3'OLIGO #2: (SEQ ID NO: 69)
[0387] 5′CCCAAGCTTTTACAGAGAGCAATTGAAGCACTG-3′
[0388] OLIGO#1 and OLIGO#2 encode NdelI and HindIII sites, and a...
Embodiment II
[0486] Various truncated and recombinant forms of soluble TNFR-I were evaluated for their ability to inhibit TNF activity. A. WEHI Cytotoxicity Analysis:
[0487] WEHI is an in vitro cell proliferation assay. (Edwards et al. (1991), Endocrinology. 128:989-996). The cell line is sensitive to TNF-[alpha] (ie, TNF-[alpha] is cytotoxic). In the presence of TNF-α inhibitors, cells are protected from cytotoxic effects and thus able to proliferate. plan:
[0488] TNF-sensitive WEHI 164 clone 13 cells (ATCC, Rockville, MD), 20 × 10 4 The cells / ml concentration were suspended in RPMI medium (Gibco, Grand Island, NY) supplemented with 5% FCS (fetal calf serum) (Hyclone, Ogden, UT), 50 U / ml penicillin and 50 mg / ml streptomycin. Adding 100 μl of cell suspension to each well of a 96-well cell culture plate can keep the cells at 37°C, 5% CO 2 Adhesion for 4 to 6 hours. 10 [mu]l of 0.0060 mg / ml actinomycin D (Sigma Chemical Co., St. Louis, MO) was added to each well. Then, 10 μl of 5...
PUM
| Property | Measurement | Unit |
|---|---|---|
| molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More